ID: 1167769790

View in Genome Browser
Species Human (GRCh38)
Location 19:51507998-51508020
Sequence GAGTTCACCAGGAAGCATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167769784_1167769790 21 Left 1167769784 19:51507954-51507976 CCTAGTGGGGGTGGGAGGGTACT No data
Right 1167769790 19:51507998-51508020 GAGTTCACCAGGAAGCATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167769790 Original CRISPR GAGTTCACCAGGAAGCATGA AGG Intergenic
No off target data available for this crispr