ID: 1167772717

View in Genome Browser
Species Human (GRCh38)
Location 19:51530971-51530993
Sequence ATGGGGACGCAGGATCAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 1, 2: 1, 3: 26, 4: 252}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167772704_1167772717 22 Left 1167772704 19:51530926-51530948 CCTGGGATGGAGATGTTGGGCCT 0: 1
1: 0
2: 3
3: 26
4: 160
Right 1167772717 19:51530971-51530993 ATGGGGACGCAGGATCAGGATGG 0: 1
1: 1
2: 1
3: 26
4: 252
1167772710_1167772717 2 Left 1167772710 19:51530946-51530968 CCTGTGGGTCAGGGCTGGTGAGG 0: 6
1: 1
2: 10
3: 37
4: 376
Right 1167772717 19:51530971-51530993 ATGGGGACGCAGGATCAGGATGG 0: 1
1: 1
2: 1
3: 26
4: 252
1167772700_1167772717 30 Left 1167772700 19:51530918-51530940 CCAGGGTCCCTGGGATGGAGATG 0: 1
1: 0
2: 6
3: 48
4: 318
Right 1167772717 19:51530971-51530993 ATGGGGACGCAGGATCAGGATGG 0: 1
1: 1
2: 1
3: 26
4: 252
1167772703_1167772717 23 Left 1167772703 19:51530925-51530947 CCCTGGGATGGAGATGTTGGGCC 0: 1
1: 0
2: 0
3: 18
4: 158
Right 1167772717 19:51530971-51530993 ATGGGGACGCAGGATCAGGATGG 0: 1
1: 1
2: 1
3: 26
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167772717 Original CRISPR ATGGGGACGCAGGATCAGGA TGG Intronic
900917351 1:5648094-5648116 GAGGGGACGAAGGAACAGGATGG + Intergenic
903325563 1:22566877-22566899 ATGGGGACAGAGGAAGAGGAGGG + Intronic
903344420 1:22675344-22675366 ATGGGCAGGCAGGAGAAGGAAGG - Intergenic
903368648 1:22820112-22820134 AAGGGGAGGCAGGCTCAGAAAGG + Intronic
903404867 1:23087903-23087925 ATGGAGAAGGAGGAACAGGAGGG + Exonic
904473590 1:30750748-30750770 ATGAGGAAACAGGCTCAGGAGGG - Intronic
907184506 1:52599618-52599640 ATGGGGAAGAAGGAGCAGGATGG + Intergenic
907256002 1:53179669-53179691 TTGGTGAGGCAGGATAAGGAAGG - Intergenic
907274677 1:53310623-53310645 CTGAGGACGCAGGATCAGCCAGG + Intronic
907628845 1:56060031-56060053 AGGGGGTAGCAGGAACAGGATGG + Intergenic
909028562 1:70511471-70511493 TTGGTGGGGCAGGATCAGGAGGG + Intergenic
909661016 1:78082150-78082172 ATGTGGAAACAGGCTCAGGAAGG + Intronic
909685110 1:78339294-78339316 ATGGGGAGGTGGGATGAGGAAGG - Intronic
911055112 1:93702191-93702213 ATGGGGGCGCAGCTTCAGGAAGG - Intronic
911117497 1:94260990-94261012 ATGGGGGTGCAGAATTAGGAAGG - Intronic
913181698 1:116328774-116328796 ATGGGGACAAAGGAAGAGGAAGG + Intergenic
913244536 1:116860076-116860098 CAGAGGACGCAGGCTCAGGAGGG - Intergenic
913552316 1:119927610-119927632 AGGGGGAAGCAGGAGAAGGAAGG - Intronic
914346714 1:146806316-146806338 ATGGTGCTGCAGGGTCAGGAAGG - Intergenic
914510708 1:148329695-148329717 AGGGCGACAGAGGATCAGGACGG - Intergenic
915713043 1:157919613-157919635 GTGGGGAAGCAGAAGCAGGAGGG - Intergenic
916964005 1:169916584-169916606 ACGGAGACCCAGGATGAGGAGGG - Intergenic
917122611 1:171657374-171657396 CTGGGGAGGCAAGTTCAGGAAGG - Intergenic
921418584 1:214919808-214919830 ATGGAGAAGGAGAATCAGGAAGG - Intergenic
922802207 1:228369620-228369642 ATGGGGATCCAGGCTCAGGCTGG - Intronic
924207112 1:241724980-241725002 ATAGGGAGGCAGGCTGAGGAAGG - Intronic
1065870551 10:29952688-29952710 ATGGCAAGGCAGGAGCAGGAGGG + Intergenic
1066176254 10:32910316-32910338 AATGGGACACAGGATCAGGTTGG + Exonic
1066436861 10:35403662-35403684 ATGGTGATGCAGGATATGGAAGG + Intronic
1066523815 10:36253385-36253407 ATGGGGAAGTAGTGTCAGGAAGG - Intergenic
1066555257 10:36605476-36605498 ATGGTGACTCAGGATGAAGATGG + Intergenic
1067548856 10:47219154-47219176 ATGGCCAGACAGGATCAGGATGG - Intergenic
1067902081 10:50252716-50252738 CTGCAGACCCAGGATCAGGATGG + Intergenic
1067977425 10:51041979-51042001 ATGGAGACTCAGGTTCAGGCAGG - Intronic
1069818057 10:71211162-71211184 CTGGGCACCCAGCATCAGGAGGG - Intergenic
1070791592 10:79192730-79192752 ATGAGGATGCAGGCTCAGGAAGG + Intronic
1071354895 10:84784362-84784384 ATGTTTAGGCAGGATCAGGATGG + Intergenic
1072478490 10:95786423-95786445 AAGGAGACGCAGGTTCAGTAGGG + Intronic
1072541992 10:96405641-96405663 ATGGAGACGGAGGATTTGGAAGG + Intronic
1074438623 10:113455622-113455644 ATGGGGAAACAGACTCAGGATGG - Intergenic
1074532194 10:114305447-114305469 GAGGGGACGCAGGTGCAGGAGGG + Intronic
1075022535 10:118962175-118962197 ATGAGGCCGGAGGAACAGGAGGG + Intergenic
1075166335 10:120071288-120071310 ATGGGAACACAGCACCAGGAGGG + Intergenic
1077420798 11:2448996-2449018 GTGGGGACAGGGGATCAGGAGGG + Intronic
1079075573 11:17383583-17383605 ATGAGGACACAGGGTCAGAAAGG - Intergenic
1079257820 11:18847716-18847738 ATGAGGAGGGAGGGTCAGGATGG + Intergenic
1079429358 11:20374119-20374141 ATGGGAAAGGAGGATGAGGAAGG + Intronic
1079488400 11:20960162-20960184 AAGAGGATGCAGGATCAGCATGG + Intronic
1079720843 11:23812027-23812049 CTAGGGATGGAGGATCAGGATGG - Intergenic
1080436597 11:32250366-32250388 ATGGAGAAGCAGGTTCAGGGAGG - Intergenic
1081670620 11:44940231-44940253 ATGGGGAGGCTGGAAGAGGAAGG - Intronic
1083372909 11:62195785-62195807 ATGTGGCCACAGGACCAGGACGG - Intergenic
1083399656 11:62414895-62414917 AAGGGGGCCCAGGCTCAGGAGGG - Intronic
1088530226 11:110800081-110800103 ATGGGGACACAGGCTCTGGGTGG + Intergenic
1090919858 11:131198097-131198119 CTTGGGAAGCATGATCAGGAAGG - Intergenic
1091303894 11:134524381-134524403 ATGGGGAACAAGGTTCAGGAGGG - Intergenic
1091933452 12:4415888-4415910 ATGGGGAAGGAAGAGCAGGAAGG + Intergenic
1093517965 12:20013368-20013390 ATGGGGACTGAGGTTGAGGAGGG - Intergenic
1094148464 12:27255822-27255844 ATGGGGTCTTAAGATCAGGACGG - Intronic
1096155484 12:49339281-49339303 ATGGGGCCTGAGGATCAGGCAGG - Intergenic
1096537680 12:52286008-52286030 AAGGGGCCTCAGGAGCAGGAAGG - Exonic
1102894067 12:116584542-116584564 AGGGGGAAGCAGGAGCAAGAAGG - Intergenic
1104429171 12:128702880-128702902 ATGGGGACAAAGGTCCAGGAAGG + Intronic
1105409770 13:20161541-20161563 CTGGGGACGCGGGTTCCGGACGG + Intergenic
1106373044 13:29155544-29155566 ATGAAGAGGCAGGCTCAGGATGG + Intronic
1111542772 13:89689886-89689908 ATGGGGAGGGAAGAGCAGGAAGG + Intergenic
1113890713 13:113734331-113734353 AAGGGGTCACAGGATGAGGAGGG + Intronic
1115293632 14:31801232-31801254 ATGGGGATCCACTATCAGGAGGG - Intronic
1116044162 14:39722398-39722420 ATGGGCAAGGAGAATCAGGAAGG - Intergenic
1119473602 14:74914069-74914091 ATGGAGAAACAGGCTCAGGAGGG - Intronic
1119543689 14:75456906-75456928 CTGGGGACTCAGGACCAAGAGGG - Intronic
1122236270 14:100332304-100332326 GTGGGGAAGCAGGGACAGGAAGG - Intergenic
1123808239 15:23897272-23897294 GTGAGGAGGCAGGAGCAGGAAGG + Intergenic
1123827766 15:24101092-24101114 GTGAGGACGCAGGAGCAGGAAGG + Intergenic
1123842220 15:24260501-24260523 GTGAGGACGCAGGAGCAGGAAGG + Intergenic
1123857247 15:24426563-24426585 GTGAGGACGCAGGAGCAGGAAGG + Intergenic
1123861876 15:24477091-24477113 GTGAGGAAGCAGGAGCAGGAAGG + Intergenic
1123871730 15:24581700-24581722 ATGAGGAGGCAGGAGCAGGAAGG + Intergenic
1123895888 15:24829480-24829502 ATGAGGAGGCAGGAGAAGGAAGG + Intronic
1123899558 15:24862913-24862935 ATGAGGAGGCAGGAGCAGGAAGG + Intronic
1124795352 15:32772912-32772934 ATGTGGAGGCTGGATCAGGAAGG + Exonic
1126662930 15:51049704-51049726 ATGGGGCTGCAGGATGATGAGGG + Intergenic
1128054887 15:64692091-64692113 ATGGGGAGGAAGTCTCAGGAGGG + Intronic
1128338411 15:66803143-66803165 ATGGGGAGGCAGGGGGAGGAGGG - Intergenic
1129505962 15:76081648-76081670 ATGGACACTCAGGTTCAGGAAGG - Intronic
1130101292 15:80896021-80896043 TTGGGGGCGCAGGATCTGCAGGG - Exonic
1133819046 16:9220446-9220468 ATTGGGACGGAGGGTCAGAAGGG + Intergenic
1134247634 16:12551841-12551863 CTGGGGACACAGGAGCAGGCAGG + Intronic
1134511654 16:14853222-14853244 ATGGTGACCCATGATAAGGAAGG + Intronic
1134699295 16:16251718-16251740 ATGGTGACCCATGATAAGGAAGG + Intronic
1134972534 16:18542954-18542976 ATGGTGACCCATGATAAGGAAGG - Intronic
1136367417 16:29815142-29815164 ATGAGGAGGCAGGAAGAGGAAGG - Intronic
1137550222 16:49432484-49432506 GTGGGGAGGAAGCATCAGGAAGG - Intergenic
1137704491 16:50525100-50525122 GGGAGGACGCAGGATCAGGCAGG - Intergenic
1139987267 16:70908954-70908976 ATGGTGCTGCAGGGTCAGGAAGG + Intronic
1140847567 16:78904956-78904978 ATTGGGAGGTAGGATAAGGATGG - Intronic
1141019419 16:80480932-80480954 ATGGGCAAGCAGTTTCAGGAGGG + Intergenic
1141108135 16:81250302-81250324 ATGGGGAGGCAGGAGCTGGTGGG - Intronic
1141780679 16:86158439-86158461 CTGGGGACACAGCATGAGGATGG + Intergenic
1203093192 16_KI270728v1_random:1229422-1229444 GTGGGGACGGGGGCTCAGGAAGG + Intergenic
1142872400 17:2829321-2829343 GTGGTGACTTAGGATCAGGAAGG + Intronic
1143459714 17:7094434-7094456 ATGGGGAATCAGGAAGAGGAAGG - Intergenic
1143669311 17:8385473-8385495 ATGGGGACACCCGAACAGGAAGG - Intergenic
1147457216 17:40545375-40545397 ATGGGGCTGCAGGATCCTGAAGG + Intergenic
1147656754 17:42095490-42095512 ATGGGGCCGCAGCAGCAGGAGGG - Intergenic
1148149505 17:45388361-45388383 ATGAGGACGCGGGATGGGGAAGG + Intergenic
1148673652 17:49432158-49432180 AAGGGAAGGCAGCATCAGGAAGG - Intronic
1148775920 17:50095697-50095719 ATGGGGAAGCAGGAACCGGCCGG + Intronic
1149557137 17:57581343-57581365 GTGGGGACATAGGATCAGGGAGG + Intronic
1151329238 17:73397118-73397140 CTGGGGAAGCAGGGTCAAGAGGG + Intronic
1151341203 17:73472080-73472102 ATGGGGACCCAGGGGCAGGGGGG - Intronic
1152442658 17:80318396-80318418 ATGGGGCCCCAGGCACAGGAGGG + Intronic
1152706871 17:81848297-81848319 ATGGTGTCGCAAGAGCAGGAGGG + Intronic
1153110569 18:1581303-1581325 AAGGGGACTCAGCATCAGAAAGG - Intergenic
1153313876 18:3703115-3703137 ATGGGGACCCAGGCACATGATGG + Intronic
1156879043 18:42053924-42053946 ATGGCAACTCAAGATCAGGAGGG - Intronic
1157126604 18:44962182-44962204 GCGGGGACCCAGGATCAGGAAGG + Intronic
1160293558 18:77617230-77617252 AAGGGGAGACAGGATCAGCAAGG + Intergenic
1160451395 18:78968740-78968762 ACTGGGAAGCAGGCTCAGGAGGG - Intergenic
1160592295 18:79951407-79951429 AAGGGGGCGCAGGCCCAGGATGG + Intronic
1160785966 19:900446-900468 ATGTGGGGGCAGGATCTGGATGG - Intronic
1160786065 19:900729-900751 ATGGGGGGGCAGGATATGGATGG - Intronic
1160929991 19:1566123-1566145 ATGGGGAGGCAGTAACAGGATGG + Intronic
1161249286 19:3271507-3271529 TTGGGGGCACAGGATCAGGGAGG + Intronic
1161373110 19:3924679-3924701 ATTGGGACTCAGGATGAGGCAGG - Exonic
1161431112 19:4233022-4233044 AAGGAGAGGCAGGAACAGGAGGG - Intronic
1163043610 19:14621957-14621979 AATGGGACACAGGATCAGGTTGG + Intronic
1165433977 19:35786953-35786975 ATGGGGGCGCAGGCTCCGGCCGG - Exonic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166698515 19:44868050-44868072 AGGGGGAAGCAGGATCAGAGAGG + Intronic
1167314089 19:48753716-48753738 AAGGGGGGGCAGGATAAGGAGGG + Intronic
1167715932 19:51142962-51142984 AGGGGCCTGCAGGATCAGGAGGG - Intronic
1167719360 19:51168051-51168073 GTGGGGACGCAGGATCAGGAGGG - Intergenic
1167725754 19:51211758-51211780 ACGGGGATGCAGGATCAGGAAGG - Intergenic
1167727422 19:51225766-51225788 GAGGGGATGCAGAATCAGGAGGG - Intronic
1167768812 19:51501125-51501147 AGGGGCTTGCAGGATCAGGAGGG + Intronic
1167772717 19:51530971-51530993 ATGGGGACGCAGGATCAGGATGG + Intronic
1168423407 19:56219919-56219941 ATGGGGAGGAAGGAAGAGGAGGG + Exonic
926136535 2:10340566-10340588 ATGGGGATGCAGGCTCAGAGGGG + Intronic
927889306 2:26738523-26738545 CTGGGAAGGGAGGATCAGGAAGG - Intergenic
928370602 2:30737450-30737472 AGGGGTACGCAGGAAGAGGATGG + Intronic
929383888 2:41382492-41382514 ATGGTGATGCAGGATATGGAAGG - Intergenic
930050855 2:47215302-47215324 ATGGGGATGAAGGATGGGGAGGG + Intergenic
930426737 2:51222433-51222455 ATGGTGAGGCAGGATAAGTAAGG - Intergenic
930524527 2:52511060-52511082 ATGGAGACTCAGTAACAGGATGG + Intergenic
933349572 2:81136692-81136714 ATGTGGAGGCTGGATCAGGGAGG - Intergenic
937358780 2:121214535-121214557 ATGGGCACACATGATCAGAATGG + Intergenic
938588380 2:132713986-132714008 ATGGTGAGGCTGGATCAGGTGGG - Intronic
942612366 2:177755544-177755566 ATGGGGTCGCAGCAGAAGGAGGG - Intronic
943088164 2:183340592-183340614 ATGGAGAAGAAGGTTCAGGAGGG - Intergenic
944064703 2:195606631-195606653 ATGGAGAAGCAGGAACAAGAAGG + Intronic
945727299 2:213487446-213487468 ATGGGTAGGCAGGATCAGTGAGG - Intronic
947724518 2:232388591-232388613 ATGGGGACGCGGGATCCGAAGGG - Intergenic
949024748 2:241761746-241761768 CTGGCTACGCAGAATCAGGATGG - Intronic
1168996718 20:2138648-2138670 CTGGGGAGGCAGGTCCAGGAGGG + Intronic
1169091735 20:2865100-2865122 ATGGGGATGAGGGACCAGGAGGG - Intronic
1170867728 20:20174928-20174950 ATGGGGACGCGGGGACAGAAAGG - Intronic
1172610701 20:36249725-36249747 ATGAGGAAGCAGGCTCAGGAAGG + Intronic
1172778304 20:37420669-37420691 ATGGGGAAGGAGGAGCAGGGAGG - Intergenic
1175315837 20:58045982-58046004 ATGGGGCCTCAGGAGGAGGAAGG - Intergenic
1175499083 20:59436781-59436803 AGGGAGAGGCAGGGTCAGGAAGG + Intergenic
1178582964 21:33851277-33851299 ATGGAGACCCAGCCTCAGGAGGG + Intronic
1179361631 21:40714584-40714606 ATGGTGAGACAGGAACAGGATGG - Intronic
1179890738 21:44333971-44333993 ATGGGGAGGGGGGCTCAGGACGG - Intronic
1181668383 22:24413810-24413832 CTGAGCACGCAGGATCAGGAGGG - Intronic
1183487558 22:38097640-38097662 ATGGGGCCCCAGGCTCAGGAAGG + Intronic
1183589082 22:38769546-38769568 CTGGGGACCCAGGATCAGTGAGG - Intronic
1184455432 22:44607278-44607300 ATGGGGATGGAGGAGGAGGAGGG + Intergenic
1184480513 22:44744176-44744198 ATGAGGATGCAGGATCAGGCGGG + Intronic
1184484185 22:44766085-44766107 ATGCAGACCCAGGATCAGGTTGG - Intronic
1184677194 22:46050177-46050199 ATGGGGCAGCAGCAGCAGGAGGG + Exonic
950435453 3:12976595-12976617 ATGTGGACGAAGGTTCAGGAAGG - Intronic
950685983 3:14618979-14619001 ATGGGGACCCACGTACAGGATGG - Intergenic
950859834 3:16138132-16138154 AGGGGTACGCAGGGTCAGCAAGG - Intergenic
952169501 3:30791422-30791444 AAGTGGAGGCAGGCTCAGGAAGG - Intronic
954846487 3:53563180-53563202 AGGGGGACAGAGGATAAGGATGG - Intronic
955644779 3:61125780-61125802 ATGGGGAAACAGGAAAAGGATGG + Intronic
955751154 3:62186460-62186482 ATGGGCACACAGGGTGAGGAGGG + Intronic
956606333 3:71076490-71076512 ATGGGCAGGCAGGACCGGGAAGG + Intronic
959883744 3:111475164-111475186 CTGGGAAAGCAGGCTCAGGATGG - Intronic
961330667 3:126136069-126136091 CTTGGGACGGAGCATCAGGAGGG - Intronic
961884048 3:130084092-130084114 ATGGTGACTGAGGCTCAGGAGGG + Intronic
962594389 3:136925515-136925537 ACGGGGCAGCAGGAACAGGAGGG - Intronic
965885276 3:173437858-173437880 TAGGGAAGGCAGGATCAGGAAGG - Intronic
967529618 3:190533537-190533559 AAGGGGACTTAGGATGAGGAAGG + Intronic
967674413 3:192278860-192278882 ATGGAGAGGGAGGAGCAGGAAGG - Intronic
969226494 4:5801866-5801888 ATGGGGAGGCAGGGACTGGATGG + Intronic
970107832 4:12605009-12605031 ATAGGGAAGCAGGAGAAGGAAGG - Intergenic
972428408 4:38956794-38956816 ATGGGGAAGCAGGCGCAGTAGGG - Intergenic
973136644 4:46716356-46716378 AAGGGGAAGCAGGAACATGATGG + Intergenic
975684447 4:76905741-76905763 ATGGGGAGGAGGGAACAGGATGG + Intergenic
976739615 4:88344914-88344936 ATGGTGATGCAGGATATGGAAGG + Intergenic
977191996 4:94012540-94012562 ATGAGGACACAGGCTCAGCATGG + Intergenic
978404477 4:108364724-108364746 ATGGGGAAGCAGGAGGAGGGTGG - Intergenic
984457774 4:179992727-179992749 TTGGGGACTCAGGACAAGGACGG + Intergenic
985912171 5:2892993-2893015 ATGGGGACACAGGAGCCAGAGGG + Intergenic
986167574 5:5288843-5288865 CTGGAGTGGCAGGATCAGGAAGG - Intronic
986459467 5:7955302-7955324 ATGGGAAGGCAGGATCAGCTAGG + Intergenic
986832438 5:11595192-11595214 ATGGGAAAACAGGATGAGGAAGG + Intronic
990510441 5:56484586-56484608 ATGGGGAAGCAGGAGGGGGATGG - Intergenic
991546579 5:67788837-67788859 ATGGGGACTCAGAGTCAGGTTGG - Intergenic
992598916 5:78376726-78376748 ATGGGGTCGGAGGATAGGGAGGG + Intronic
992947758 5:81826100-81826122 ATGAGGACACAGGCTCAGGAGGG + Intergenic
995906791 5:117134365-117134387 CTGGGGAAAAAGGATCAGGAGGG + Intergenic
997197075 5:131987458-131987480 ATAGGGAGGCAGGAGAAGGAGGG + Intronic
999495397 5:152091534-152091556 TTGGGGACAGAGGGTCAGGAAGG - Intergenic
1000478588 5:161743895-161743917 ATGGGGAGGAAAGAGCAGGAAGG - Intergenic
1001758496 5:174188666-174188688 AGGGTGAGGGAGGATCAGGATGG - Intronic
1003199809 6:3948963-3948985 AGGGGGACTCAGGACCAGGTAGG + Intergenic
1005169565 6:22967299-22967321 ATGGGGAAGAAGCACCAGGAAGG - Intergenic
1007168193 6:39843323-39843345 ATGGGGAAGAAAGATCAGGGTGG + Intronic
1010934993 6:81850242-81850264 ATGGGTACTCAGGATCACTAAGG + Intergenic
1015210663 6:130694865-130694887 ATGGAGAAGCAGCAGCAGGAAGG + Intergenic
1016836416 6:148481612-148481634 ATGGGGAGGCTTGAGCAGGAGGG + Intronic
1017922537 6:158884723-158884745 ATGGTGGTGCAGGATCTGGAAGG + Intronic
1018697202 6:166399607-166399629 ATGTGGACGCAGGATTGGAAGGG + Intergenic
1019351796 7:557479-557501 ATGGGTGCGCAGGCACAGGACGG - Intronic
1019448685 7:1084718-1084740 ATGGGCACTGAGGCTCAGGAAGG + Intronic
1019522735 7:1468021-1468043 ATGGGGAAGGAGGATGGGGAGGG - Intergenic
1022378625 7:29839095-29839117 TGGGGGACTCAGGATCAGAAAGG + Intronic
1023983984 7:45084864-45084886 AAGGGGCTGCAGGCTCAGGATGG - Exonic
1026593140 7:71713309-71713331 ATGGGGACGAGGGATGAGAAGGG + Exonic
1026735558 7:72946421-72946443 AAGGGGAAGCAGGATGCGGAGGG + Intronic
1026785896 7:73301351-73301373 AAGGGGAAGCAGGATGCGGAGGG + Intergenic
1027108168 7:75418587-75418609 AAGGGGAAGCAGGATGCGGAGGG - Exonic
1028427536 7:90706968-90706990 ATGGGGAGGCAGGACAGGGAGGG - Intronic
1028705475 7:93839915-93839937 TTGGGGAAGGAGGATCATGAGGG + Intronic
1029115003 7:98232223-98232245 ATGGGGAGACAGGCTCGGGAGGG + Intronic
1029184201 7:98727012-98727034 ATGGGGAGGCAGGTGCAGGCAGG + Intergenic
1033586696 7:142779641-142779663 ATGGAGGAGCAGGAGCAGGAGGG - Intergenic
1034277269 7:149829401-149829423 AGGGGGACACAGGAGGAGGAGGG - Intergenic
1034563310 7:151895067-151895089 AGGAGGACGCAGGAGCAGGGAGG - Intergenic
1034643747 7:152625924-152625946 ATGGGGAAGCAGGAACAAGGGGG + Intergenic
1036619653 8:10416077-10416099 CTGGGGAAGCAGGCTCAGGCAGG - Intronic
1037733149 8:21546116-21546138 ATGGGGATGCAGGAGAAGGAGGG + Intergenic
1037918228 8:22785680-22785702 ATGAGGACTCAGGCTCAGGGAGG - Intronic
1039291082 8:36095126-36095148 AGGGGGACTCAGGAGGAGGAAGG + Intergenic
1042159217 8:65875106-65875128 ATGGGGATCCAGAAGCAGGATGG + Intergenic
1042833155 8:73053434-73053456 ATGGGGAAGGAGGAGGAGGAGGG - Intergenic
1043372493 8:79611324-79611346 ATGGTAACACAGGACCAGGAAGG + Intronic
1049083131 8:140457910-140457932 ATGGGGAGGGAGGAGGAGGAGGG + Intronic
1049179458 8:141214331-141214353 ACAGGTACGAAGGATCAGGAAGG + Intronic
1049287536 8:141783947-141783969 TTGGGGAGGCAGGAACATGAGGG - Intergenic
1049696064 8:143984878-143984900 GTGGGGTTGCAGGAACAGGAGGG - Exonic
1049804937 8:144534457-144534479 ACGGCCACGCAGGAACAGGAAGG + Intronic
1050068838 9:1789327-1789349 ATGAGGACACAGGACCAGGAAGG - Intergenic
1050715751 9:8523223-8523245 ATGGGGACAGTGGAGCAGGAAGG + Intronic
1051901301 9:22044702-22044724 ATGGGGATACAGGCACAGGAAGG - Intergenic
1055018225 9:71642191-71642213 ATGGGGGAGCAGGAAGAGGAGGG + Intergenic
1056835390 9:89951096-89951118 CTGAGGATGCAGGACCAGGAAGG + Intergenic
1056860732 9:90178661-90178683 AAGGGGAGGCAGGATAAGCAGGG + Intergenic
1057847507 9:98536899-98536921 CTGGGGACTGAGGAGCAGGATGG - Intronic
1059431908 9:114255431-114255453 ATGGGGAGACAGGCCCAGGACGG - Intronic
1059805613 9:117797034-117797056 ATGAGGAAGCATGATCATGATGG + Intergenic
1060036997 9:120264222-120264244 ATGGGGACGCAGGAGAAGCTGGG - Intergenic
1060128862 9:121075674-121075696 ATGAGGAAACATGATCAGGAAGG - Intronic
1060196283 9:121625635-121625657 ATGGGATGGCAGGATCAGGAGGG + Intronic
1060597464 9:124856897-124856919 ATGGGTAGGTAGGAGCAGGATGG - Intronic
1060765351 9:126291650-126291672 GTGGGGAAGAAGGATCAGGAGGG - Intergenic
1061048043 9:128177992-128178014 ATGGGGAAACAGACTCAGGAGGG + Intronic
1061703824 9:132437027-132437049 GTGGGGAGACAGGAACAGGAGGG + Intronic
1061719848 9:132544835-132544857 ATGGGGACGCTGCCTGAGGAGGG + Intronic
1061799111 9:133104477-133104499 AGGGGGAGGCAGGCTCAGGAAGG - Intronic
1061808919 9:133151332-133151354 ATGGGGTCCCTGGGTCAGGATGG - Intergenic
1061879108 9:133559813-133559835 ATGGGGACCAAGGCCCAGGAAGG - Intronic
1061917063 9:133760791-133760813 CTGAGGACGGAGGATCAGGAAGG + Intergenic
1061917084 9:133760884-133760906 CTGAGGACGAGGGATCAGGAAGG + Intergenic
1061917091 9:133760915-133760937 CTGAGGACGGCGGATCAGGAAGG + Intergenic
1061917098 9:133760946-133760968 CTGAGGACGAAGGATCGGGAAGG + Intergenic
1062056560 9:134472106-134472128 AGGAGGACCCAGGCTCAGGAAGG - Intergenic
1062194306 9:135264422-135264444 AAGGAGACTCAGGATTAGGAGGG + Intergenic
1185913793 X:4011651-4011673 ATGGGGAAGGAGGAGCAGGAAGG - Intergenic
1189058777 X:37729246-37729268 ATGGGGAGGCAGGAGTAAGATGG - Exonic
1189175533 X:38953616-38953638 AGGGGGAAGCAGCAGCAGGAAGG - Intergenic
1191688971 X:63920703-63920725 ATGGGGAAACAGGATCAGACAGG - Intergenic
1192925415 X:75750211-75750233 ATGGGGATGGAGGATGGGGAGGG - Intergenic
1192968307 X:76203203-76203225 ATGGAGACTCAGGATCATCAGGG - Intergenic
1196906304 X:120439858-120439880 AAGTGGAAACAGGATCAGGAAGG + Intronic
1199600237 X:149537324-149537346 AGGGGAAGGCAGGAGCAGGACGG + Intergenic
1199650347 X:149942616-149942638 AGGGGAAGGCAGGAGCAGGACGG - Intergenic
1201486138 Y:14496469-14496491 AAGAGGAGGCAGGATGAGGAAGG - Intergenic