ID: 1167773299

View in Genome Browser
Species Human (GRCh38)
Location 19:51537214-51537236
Sequence CCCTTGAGAATACGATCAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167773295_1167773299 0 Left 1167773295 19:51537191-51537213 CCTTATAAAGGAGCCTATCAGGG No data
Right 1167773299 19:51537214-51537236 CCCTTGAGAATACGATCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167773299 Original CRISPR CCCTTGAGAATACGATCAAG TGG Intergenic
No off target data available for this crispr