ID: 1167774737

View in Genome Browser
Species Human (GRCh38)
Location 19:51547414-51547436
Sequence TACCCTCCCAGGTGTCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167774737_1167774750 17 Left 1167774737 19:51547414-51547436 CCCCCAGGACACCTGGGAGGGTA No data
Right 1167774750 19:51547454-51547476 TGCCAGGGAAATGGTCAGGCAGG No data
1167774737_1167774747 8 Left 1167774737 19:51547414-51547436 CCCCCAGGACACCTGGGAGGGTA No data
Right 1167774747 19:51547445-51547467 GACTTCCAGTGCCAGGGAAATGG No data
1167774737_1167774746 2 Left 1167774737 19:51547414-51547436 CCCCCAGGACACCTGGGAGGGTA No data
Right 1167774746 19:51547439-51547461 AGGGTGGACTTCCAGTGCCAGGG No data
1167774737_1167774749 13 Left 1167774737 19:51547414-51547436 CCCCCAGGACACCTGGGAGGGTA No data
Right 1167774749 19:51547450-51547472 CCAGTGCCAGGGAAATGGTCAGG No data
1167774737_1167774745 1 Left 1167774737 19:51547414-51547436 CCCCCAGGACACCTGGGAGGGTA No data
Right 1167774745 19:51547438-51547460 AAGGGTGGACTTCCAGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167774737 Original CRISPR TACCCTCCCAGGTGTCCTGG GGG (reversed) Intergenic