ID: 1167775220

View in Genome Browser
Species Human (GRCh38)
Location 19:51550191-51550213
Sequence GAACATACCTGTTTCTTATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167775220_1167775226 1 Left 1167775220 19:51550191-51550213 CCAGATAAGAAACAGGTATGTTC No data
Right 1167775226 19:51550215-51550237 TGCCTCTGGGGCTCTCTCCTGGG No data
1167775220_1167775233 30 Left 1167775220 19:51550191-51550213 CCAGATAAGAAACAGGTATGTTC No data
Right 1167775233 19:51550244-51550266 TCTCTACTGGTCACAGTCAGAGG No data
1167775220_1167775227 2 Left 1167775220 19:51550191-51550213 CCAGATAAGAAACAGGTATGTTC No data
Right 1167775227 19:51550216-51550238 GCCTCTGGGGCTCTCTCCTGGGG No data
1167775220_1167775229 17 Left 1167775220 19:51550191-51550213 CCAGATAAGAAACAGGTATGTTC No data
Right 1167775229 19:51550231-51550253 TCCTGGGGACCCTTCTCTACTGG No data
1167775220_1167775225 0 Left 1167775220 19:51550191-51550213 CCAGATAAGAAACAGGTATGTTC No data
Right 1167775225 19:51550214-51550236 CTGCCTCTGGGGCTCTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167775220 Original CRISPR GAACATACCTGTTTCTTATC TGG (reversed) Intergenic
No off target data available for this crispr