ID: 1167775224

View in Genome Browser
Species Human (GRCh38)
Location 19:51550213-51550235
Sequence CAGGAGAGAGCCCCAGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167775224_1167775234 24 Left 1167775224 19:51550213-51550235 CCTGCCTCTGGGGCTCTCTCCTG No data
Right 1167775234 19:51550260-51550282 TCAGAGGCAGTGTCATTCATTGG No data
1167775224_1167775233 8 Left 1167775224 19:51550213-51550235 CCTGCCTCTGGGGCTCTCTCCTG No data
Right 1167775233 19:51550244-51550266 TCTCTACTGGTCACAGTCAGAGG No data
1167775224_1167775235 25 Left 1167775224 19:51550213-51550235 CCTGCCTCTGGGGCTCTCTCCTG No data
Right 1167775235 19:51550261-51550283 CAGAGGCAGTGTCATTCATTGGG No data
1167775224_1167775229 -5 Left 1167775224 19:51550213-51550235 CCTGCCTCTGGGGCTCTCTCCTG No data
Right 1167775229 19:51550231-51550253 TCCTGGGGACCCTTCTCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167775224 Original CRISPR CAGGAGAGAGCCCCAGAGGC AGG (reversed) Intergenic
No off target data available for this crispr