ID: 1167775233

View in Genome Browser
Species Human (GRCh38)
Location 19:51550244-51550266
Sequence TCTCTACTGGTCACAGTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167775224_1167775233 8 Left 1167775224 19:51550213-51550235 CCTGCCTCTGGGGCTCTCTCCTG No data
Right 1167775233 19:51550244-51550266 TCTCTACTGGTCACAGTCAGAGG No data
1167775228_1167775233 4 Left 1167775228 19:51550217-51550239 CCTCTGGGGCTCTCTCCTGGGGA No data
Right 1167775233 19:51550244-51550266 TCTCTACTGGTCACAGTCAGAGG No data
1167775220_1167775233 30 Left 1167775220 19:51550191-51550213 CCAGATAAGAAACAGGTATGTTC No data
Right 1167775233 19:51550244-51550266 TCTCTACTGGTCACAGTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167775233 Original CRISPR TCTCTACTGGTCACAGTCAG AGG Intergenic
No off target data available for this crispr