ID: 1167781109

View in Genome Browser
Species Human (GRCh38)
Location 19:51599504-51599526
Sequence TACCTTGTAGGAGCTAAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 97}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167781101_1167781109 21 Left 1167781101 19:51599460-51599482 CCAATTCTGGACACATTGGTACA 0: 1
1: 1
2: 18
3: 89
4: 360
Right 1167781109 19:51599504-51599526 TACCTTGTAGGAGCTAAGGCTGG 0: 1
1: 0
2: 0
3: 7
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167781109 Original CRISPR TACCTTGTAGGAGCTAAGGC TGG Intergenic
902255895 1:15188395-15188417 TTCCTTGCAGGTTCTAAGGCTGG - Intronic
904003115 1:27349746-27349768 CACCGTGGAGGAGTTAAGGCTGG - Exonic
907784395 1:57597592-57597614 TACATTTTATGAGCTAAGTCAGG + Intronic
912067349 1:105760319-105760341 TCCCATGTTGCAGCTAAGGCAGG - Intergenic
914764534 1:150626379-150626401 TACCTTGCTGGAGGCAAGGCAGG - Intronic
917491068 1:175499069-175499091 AACCTTGAAGGAGCCAAAGCCGG - Intronic
920283175 1:204859328-204859350 TCCCATCTAGGGGCTAAGGCGGG - Intronic
923683810 1:236140893-236140915 CACCTTGGAAGAGATAAGGCAGG + Intergenic
1063088063 10:2837195-2837217 TTCCCTGTAGGAGGTGAGGCTGG - Intergenic
1063502344 10:6566620-6566642 TCCCTTGTAGGAGAAAAGACTGG - Intronic
1063771201 10:9203761-9203783 TAACTTGTAGGAGTTGAAGCAGG + Intergenic
1068634962 10:59338659-59338681 TACCTTGGGGAAGCTGAGGCAGG - Intronic
1069576745 10:69536010-69536032 TACTTAGTAGGAGGGAAGGCCGG + Intergenic
1070761672 10:79027976-79027998 TACCTGGTAGGTGCTAGGTCAGG - Intergenic
1070917106 10:80161925-80161947 CACCTGGTAGCAGGTAAGGCAGG - Exonic
1078496086 11:11818628-11818650 TAACTAGTAGGAGCTCAGGGAGG + Intergenic
1085099093 11:73785461-73785483 AATATTGTAGGAGCAAAGGCAGG + Intergenic
1086424965 11:86673900-86673922 TACCTGGTAGGAAATAAGGATGG + Intergenic
1089479211 11:118791495-118791517 TACTTTGGAGGGGCGAAGGCAGG - Intergenic
1091181631 11:133609852-133609874 TACGTTGTTGGAGCCAAGGGCGG - Intergenic
1093687107 12:22069705-22069727 TAACTTGTAGGAACGACGGCTGG - Intronic
1096760250 12:53835908-53835930 TTCCTTCTAGCATCTAAGGCTGG + Intergenic
1102987777 12:117292426-117292448 TGGCTTGGAGGAGCTCAGGCTGG + Intronic
1105588925 13:21772990-21773012 TACCTAGTAGGATCTCAGTCAGG + Intergenic
1106037386 13:26056423-26056445 CACTTTGTAGGAGTTGAGGCAGG + Intergenic
1107948474 13:45441130-45441152 CACTTTGTGGGGGCTAAGGCAGG + Intergenic
1110471237 13:75862470-75862492 AACCTTTTAGGAGGTAAGGATGG + Intergenic
1111468449 13:88646558-88646580 TCCCTTGTAGGGGCTAAGTGAGG - Intergenic
1120244467 14:81990474-81990496 AAACTTTTAGGAGCTAAGGATGG - Intergenic
1121161381 14:91744460-91744482 CAGCTTCTAGGAGCTAAGGGTGG + Intronic
1121894996 14:97638528-97638550 TACATTGTAGGGGATAAGGTAGG - Intergenic
1121925031 14:97919768-97919790 CACTTTGTGGGAGCTGAGGCAGG - Intergenic
1123970723 15:25505624-25505646 TACTGTGCAGGAGCTAAGGGAGG - Intergenic
1128901597 15:71427703-71427725 TACCTTGGAGGAACTAAGAATGG - Intronic
1133834976 16:9359759-9359781 TACCTTGTAGGACATCAAGCAGG - Intergenic
1135341138 16:21649100-21649122 TACTTTTGAGAAGCTAAGGCAGG - Intronic
1136562983 16:31052051-31052073 TACTTTGTTGGGGCTAAGGCAGG - Intergenic
1137735276 16:50719159-50719181 TACCTCCAAGGAGCTGAGGCTGG + Intronic
1138460581 16:57145492-57145514 CACCTTGCGGGAGCTAAAGCAGG - Intronic
1139621046 16:68142983-68143005 TACCTTGTGGGGGCTGAGGAGGG + Intronic
1140166330 16:72555698-72555720 TACCATTTAGAAGCTAAGGCGGG + Intergenic
1146674099 17:34761095-34761117 AACCTTGTGGGAGCTAGAGCTGG - Intergenic
1167781109 19:51599504-51599526 TACCTTGTAGGAGCTAAGGCTGG + Intergenic
1168443499 19:56391982-56392004 TGCCTTGCAGCAGCTAAAGCTGG - Intronic
929715969 2:44310001-44310023 TACTTTGTGGGAGCTAATGCAGG - Intronic
930307533 2:49694220-49694242 TACCTTGCAGCTGCTAGGGCTGG + Intergenic
931373049 2:61682046-61682068 TGCCTAGTAGGAGATAAGGTTGG + Intergenic
933330347 2:80885381-80885403 TCCCTTTCAGGATCTAAGGCAGG + Intergenic
937050900 2:118888348-118888370 TGACTAGTAGGAGCTAAGTCTGG + Intergenic
939550032 2:143603717-143603739 TACCTTGTAAGAGCTGCCGCTGG - Intronic
946071231 2:217035927-217035949 TTCCTTGGAGGAGCTGGGGCAGG + Intergenic
946840533 2:223815321-223815343 GACTTTGAAGGAGCTAATGCTGG + Intronic
1169016205 20:2294703-2294725 TACCTTCAAGGAGCTCAGTCTGG + Intergenic
1170822695 20:19767676-19767698 GACTTTGTGGGGGCTAAGGCGGG + Intergenic
1172649549 20:36493111-36493133 TGCATTGCAGAAGCTAAGGCTGG - Intronic
1178978833 21:37244062-37244084 TGCCCTGGAGGAGCTAAGTCTGG + Intronic
1179302101 21:40121799-40121821 TACTTGGGAGGAGCTGAGGCAGG - Intronic
1183137853 22:35907082-35907104 TATCATGTGGGAGATAAGGCTGG + Intronic
1184243172 22:43222169-43222191 TAGCTGGCAGGAGCTAAGGCTGG + Intronic
955519745 3:59763607-59763629 TACATTCTAGGAGAGAAGGCAGG + Intronic
959542010 3:107550704-107550726 AACCATGTAGGATCTAAAGCAGG + Intronic
959930718 3:111979099-111979121 TACCTTGTCGGAGCTGGGGCTGG + Exonic
962312493 3:134336562-134336584 TGCCTTGGAGGAGCTCAAGCTGG - Intergenic
962482132 3:135806914-135806936 GACCTGGTCTGAGCTAAGGCAGG - Intergenic
963037901 3:141048370-141048392 TTCCTTGTGGGAGCAAAGGCAGG + Intergenic
964495393 3:157283991-157284013 TACATTCTAGGCGCTAAGACAGG + Intronic
967080431 3:186044637-186044659 AAAGTTGGAGGAGCTAAGGCTGG + Intergenic
967829801 3:193909290-193909312 TACCCTGCAGGAGCTGGGGCAGG + Intergenic
976353277 4:84084716-84084738 TACCTTGTAGTCCCCAAGGCAGG - Intergenic
982940514 4:161546985-161547007 TACCTTTTATGACCTAATGCTGG - Intronic
988501339 5:31786224-31786246 TTGCTTGCAGGAGCTAGGGCTGG - Intronic
993363565 5:87007262-87007284 AATCTTTTAGGAGCTTAGGCTGG - Intergenic
997226838 5:132215305-132215327 TACCTGGAAGGAGATAGGGCAGG - Intronic
998940159 5:147273052-147273074 ACCCTTGTAGAAGGTAAGGCAGG - Intronic
999197115 5:149789928-149789950 GACCTTGTGGGAGGTAAGGAAGG + Intronic
999220190 5:149969722-149969744 GAAGTTGTAGGAGATAAGGCTGG - Intronic
999900515 5:156081637-156081659 CACTTTGTGGGGGCTAAGGCAGG - Intronic
1001211038 5:169810592-169810614 TTCCTTGTAAGAGTTAAAGCAGG + Intronic
1005073831 6:21887960-21887982 AACCTTCTATGAGCTAAGTCAGG - Intergenic
1006143696 6:31945871-31945893 TACTGGGGAGGAGCTAAGGCCGG + Exonic
1006220622 6:32487291-32487313 TCCATTGTTGGAGGTAAGGCCGG + Intergenic
1006275402 6:33001363-33001385 TTCCTTGCAGCAGCCAAGGCAGG + Intergenic
1007986462 6:46211973-46211995 TACCTTGGAGGGGCTGAGGTGGG + Intergenic
1008305173 6:49891433-49891455 TACATTGTAGGAGATAGGTCAGG - Intergenic
1009840626 6:69069114-69069136 TACTTAGAAGGAGCTAAGTCTGG - Intronic
1011959980 6:93076019-93076041 TACCTTATAAGTGCTAAGTCAGG - Intergenic
1012204685 6:96445827-96445849 CACCTTGAAGAAGCAAAGGCAGG + Intergenic
1019047969 6:169162642-169162664 GACATTGTACGAGCCAAGGCAGG - Intergenic
1020153602 7:5703067-5703089 CACCTTGGAGGAGCAAGGGCAGG + Intronic
1024041099 7:45555452-45555474 TATCTTATATGAGATAAGGCAGG + Intergenic
1025618295 7:63143475-63143497 TACCTTGTTGTAGGTAAGGAAGG - Intergenic
1031313711 7:120231353-120231375 CACTTTGGAGGGGCTAAGGCAGG + Intergenic
1031352850 7:120756735-120756757 TTTCTTGTAGTAGCTAATGCAGG - Intergenic
1034401712 7:150865995-150866017 TACTTTGGAGGGGCCAAGGCGGG + Intergenic
1035949085 8:3999305-3999327 CACTTTGTAAGAGCTCAGGCCGG - Intronic
1039939465 8:42077030-42077052 AACGTTTTAGGAGCTGAGGCAGG + Intergenic
1052709857 9:32040632-32040654 TAGGTTCTAGGAGCTAGGGCAGG - Intergenic
1053353135 9:37426242-37426264 TACCTTGAAGTAGCAAAGGCAGG + Intronic
1054921317 9:70545656-70545678 CTACTTGTGGGAGCTAAGGCAGG - Intronic
1059716811 9:116920839-116920861 TAGCTAGTAGGAGCAAAGCCAGG + Intronic
1187794921 X:22993309-22993331 TACATAGTAGGAAATAAGGCAGG - Intergenic
1191870418 X:65740641-65740663 TTCCTTGTAGGAGTATAGGCCGG + Exonic
1192065395 X:67879782-67879804 TATCATCCAGGAGCTAAGGCCGG - Intergenic
1192173571 X:68872060-68872082 TACCAAGTAGGAGCAAAGGTGGG + Intergenic
1196938126 X:120749746-120749768 TACTTTGTAAGGGCTAAGGGTGG - Intergenic