ID: 1167782463

View in Genome Browser
Species Human (GRCh38)
Location 19:51608060-51608082
Sequence TCTCAAATGCAGAGGTAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167782463_1167782468 2 Left 1167782463 19:51608060-51608082 CCTTCTTACCTCTGCATTTGAGA No data
Right 1167782468 19:51608085-51608107 GGACAGAGTTCTGCTCCCAGGGG No data
1167782463_1167782469 3 Left 1167782463 19:51608060-51608082 CCTTCTTACCTCTGCATTTGAGA No data
Right 1167782469 19:51608086-51608108 GACAGAGTTCTGCTCCCAGGGGG No data
1167782463_1167782466 0 Left 1167782463 19:51608060-51608082 CCTTCTTACCTCTGCATTTGAGA No data
Right 1167782466 19:51608083-51608105 CAGGACAGAGTTCTGCTCCCAGG No data
1167782463_1167782472 29 Left 1167782463 19:51608060-51608082 CCTTCTTACCTCTGCATTTGAGA No data
Right 1167782472 19:51608112-51608134 TCCACCCGCCATGCCCGATTTGG No data
1167782463_1167782467 1 Left 1167782463 19:51608060-51608082 CCTTCTTACCTCTGCATTTGAGA No data
Right 1167782467 19:51608084-51608106 AGGACAGAGTTCTGCTCCCAGGG No data
1167782463_1167782474 30 Left 1167782463 19:51608060-51608082 CCTTCTTACCTCTGCATTTGAGA No data
Right 1167782474 19:51608113-51608135 CCACCCGCCATGCCCGATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167782463 Original CRISPR TCTCAAATGCAGAGGTAAGA AGG (reversed) Intergenic
No off target data available for this crispr