ID: 1167782856

View in Genome Browser
Species Human (GRCh38)
Location 19:51611716-51611738
Sequence CACATCATGAACCAAGTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 130}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167782856 Original CRISPR CACATCATGAACCAAGTGCC AGG Intergenic
901195072 1:7435869-7435891 CACAGCATGACCCAGGGGCCTGG + Intronic
904452007 1:30619313-30619335 CACATCAGGGAACAAGTGGCTGG + Intergenic
905421507 1:37849080-37849102 CACACCATGAACTAATTGCATGG - Intronic
907519027 1:55011219-55011241 CCCATCATGCAGCAAGAGCCAGG - Intergenic
908028354 1:59973953-59973975 AGCAGCATGACCCAAGTGCCTGG + Intergenic
911069182 1:93818638-93818660 CATATAATGAAACAAATGCCTGG - Intronic
913069675 1:115287205-115287227 CACATCAAGGCACAAGTGCCAGG - Intronic
914942251 1:152033588-152033610 CACAACATGAAACAAGACCCTGG - Intronic
915327555 1:155088496-155088518 CACTTGCTGAGCCAAGTGCCTGG + Intergenic
916910593 1:169341577-169341599 CACAGCTTGCACCATGTGCCTGG + Intronic
919801108 1:201355120-201355142 CACACGCTGAACCACGTGCCAGG + Intergenic
920271815 1:204770786-204770808 GGCATCATGAACCAAGTGATGGG + Intergenic
924170803 1:241338467-241338489 CACATGAGGAACCAATTTCCAGG + Intronic
1063086792 10:2826848-2826870 CACATCATGATGAAACTGCCTGG + Intergenic
1068284230 10:54913635-54913657 AACATCTTGCACCAAGTGCTTGG + Intronic
1071379903 10:85048118-85048140 CACCTCATGAGCCAACTGCAAGG - Intergenic
1073593187 10:104775897-104775919 CACATCATCAAGCACTTGCCAGG - Intronic
1079320628 11:19448542-19448564 CCCATGAAGAACCACGTGCCAGG - Intronic
1080571768 11:33563424-33563446 CACATCATGGAAGATGTGCCTGG + Intronic
1083803277 11:65058695-65058717 CACATCCTGCACCATTTGCCTGG + Intergenic
1085008309 11:73115269-73115291 CACACCATGCAGCCAGTGCCAGG + Intronic
1086519197 11:87650785-87650807 GACAGCATGCACCATGTGCCTGG - Intergenic
1086885852 11:92204908-92204930 CACTTCTTGAAACTAGTGCCAGG - Intergenic
1094114315 12:26893814-26893836 CATTTAATGAACCATGTGCCAGG - Intergenic
1098078495 12:66758947-66758969 GACAGCTTGAACCATGTGCCTGG - Intronic
1106914117 13:34494040-34494062 CTCAAAATGAACCAAGTGCATGG + Intergenic
1107991275 13:45820814-45820836 CGCAGCAGGAAGCAAGTGCCAGG - Intronic
1108739099 13:53316708-53316730 CTCATTATGAACACAGTGCCAGG + Intergenic
1110395459 13:75024909-75024931 CTTAACATGAGCCAAGTGCCTGG - Intergenic
1110489483 13:76086773-76086795 CACAGCTTGCACCATGTGCCTGG - Intergenic
1110644465 13:77866444-77866466 CACATCATGTATCAGGTGCTAGG + Intergenic
1112150322 13:96753056-96753078 CACATCATAAACCAACTGTCTGG + Intronic
1112259269 13:97863587-97863609 GACAGCTTGTACCAAGTGCCTGG - Intergenic
1114780414 14:25532796-25532818 GACAGCTTGCACCAAGTGCCTGG - Intergenic
1115526275 14:34283706-34283728 CACATTATGAAGCAAGTCCTGGG - Intronic
1119954906 14:78787205-78787227 CACATTGTGAAACAACTGCCAGG + Intronic
1124414568 15:29464557-29464579 TACTTCAGGAAGCAAGTGCCAGG + Intronic
1125246515 15:37647238-37647260 AACAGCATGTACCATGTGCCTGG + Intergenic
1129704957 15:77788910-77788932 CACACCATGTACCATGTTCCTGG + Intronic
1137963920 16:52912354-52912376 CTCAACATCAAGCAAGTGCCCGG - Intergenic
1142968031 17:3592935-3592957 CACATCATCAGCCAGGTGCCCGG + Intronic
1143191749 17:5044989-5045011 CAGAGCATGAACCAAGACCCAGG - Intronic
1149410313 17:56398216-56398238 TGTATCATGTACCAAGTGCCAGG - Intronic
1151624288 17:75267022-75267044 CACAGCATTTGCCAAGTGCCAGG + Intronic
1160238318 18:77103607-77103629 CACAGCATGGACCAAGAGCAAGG + Intronic
1160419255 18:78732815-78732837 CACAGCATGAACCATGGGCCAGG - Intergenic
1165187293 19:34033027-34033049 GAGATCATGAACCAAGTCCTGGG + Intergenic
1167782856 19:51611716-51611738 CACATCATGAACCAAGTGCCAGG + Intergenic
925987710 2:9229800-9229822 GAGAACATGAAGCAAGTGCCTGG + Intronic
925991293 2:9257009-9257031 CACATCCTGAAGAAAGTGACAGG - Intronic
927396241 2:22654756-22654778 GACAGCATGCACCATGTGCCTGG + Intergenic
927695123 2:25234618-25234640 CAGATCACCAACCATGTGCCAGG + Intronic
934809530 2:97267881-97267903 GACCTCAAGAACTAAGTGCCAGG - Intergenic
936593999 2:113830396-113830418 CTTATCATGTACCTAGTGCCAGG - Intergenic
936836540 2:116717466-116717488 CAGACCAGGAACCAACTGCCTGG - Intergenic
938171205 2:129078520-129078542 CACAGCATGACCCCAGTGCTAGG + Intergenic
944011416 2:194979326-194979348 GACAGCTTGAACCATGTGCCTGG - Intergenic
944655315 2:201871598-201871620 CAGAGCATGTACCAAGTGCTGGG - Intronic
946738042 2:222774103-222774125 AAGACCATGAACCATGTGCCAGG - Intergenic
948586265 2:239021770-239021792 CACAAAATGACCCAAGTGTCGGG + Intergenic
1169080214 20:2793907-2793929 CTCTTCTTGAACCAAGGGCCTGG - Intergenic
1172594192 20:36138606-36138628 CAAATCATTAACCCAGTTCCTGG - Intronic
1177504263 21:22000510-22000532 CACAACTTGCACCATGTGCCTGG - Intergenic
1178412534 21:32377501-32377523 GATATCCTGAACCTAGTGCCTGG + Intronic
1183512636 22:38245039-38245061 CACATCCAGAACCAAGTCCCCGG + Intronic
1183539250 22:38420022-38420044 CACAGCCAGAAGCAAGTGCCTGG - Intergenic
1184309751 22:43633663-43633685 CACGTCTGGAACCAAGTCCCTGG - Intronic
949295119 3:2512680-2512702 AACAGCATGAACCAATGGCCAGG + Intronic
950325983 3:12110389-12110411 AACAGCTTGCACCAAGTGCCCGG - Intronic
952718977 3:36512831-36512853 CACATTCTAAATCAAGTGCCTGG - Intronic
953557774 3:43960358-43960380 CAGAGCATTAACCAAGTGCAGGG - Intergenic
956070264 3:65441865-65441887 CACAAGATGAAAAAAGTGCCAGG - Intronic
958878252 3:99639690-99639712 AACTTCATGGACCAAGTGTCTGG - Intronic
959113767 3:102151975-102151997 CACAGCCTGCACCATGTGCCTGG - Intronic
959818493 3:110704053-110704075 CACAGCTTGCACCATGTGCCTGG - Intergenic
960057741 3:113287202-113287224 CTCGTGATGAACCATGTGCCTGG - Exonic
960951323 3:123000381-123000403 GTCATCATGAGGCAAGTGCCAGG + Intronic
961521542 3:127469916-127469938 CATATGATCAACCAAGAGCCTGG - Intergenic
962443327 3:135443312-135443334 CACATCATTAACCATTTGACAGG + Intergenic
962976201 3:140448167-140448189 CACATGGTGAACTAAGTGGCTGG + Intronic
968286464 3:197511926-197511948 CAGATCATGACCCACTTGCCTGG - Exonic
975431081 4:74291620-74291642 CACATGATAAATAAAGTGCCTGG + Intronic
975668023 4:76753336-76753358 CACAAGATCATCCAAGTGCCAGG - Intronic
979539902 4:121869884-121869906 CACAGTAAGAAACAAGTGCCTGG + Intronic
979854201 4:125611401-125611423 GACAGCGTGAACCATGTGCCTGG + Intergenic
982124043 4:152169184-152169206 AACAGTATGCACCAAGTGCCTGG - Intergenic
982301245 4:153881327-153881349 GACAGCTTGCACCAAGTGCCTGG + Intergenic
984542172 4:181052713-181052735 CACATCGTTTACCAAGTGGCGGG - Intergenic
984750042 4:183263406-183263428 CACAGCAAGACCCAAGTGTCAGG - Intronic
986190402 5:5491636-5491658 CACATCGGTAGCCAAGTGCCTGG - Intergenic
987199972 5:15567212-15567234 CACATCAGGAAACAGGGGCCAGG - Intronic
987260350 5:16196243-16196265 GACATCTTGCACCATGTGCCTGG - Intergenic
988137710 5:27196343-27196365 CATATCATGACCCCAGTGTCAGG + Intergenic
988147701 5:27331294-27331316 GACAGCTTGCACCAAGTGCCAGG + Intergenic
997411187 5:133692264-133692286 CCCAAGATGAGCCAAGTGCCTGG + Intergenic
999925157 5:156367843-156367865 CACAGCATGAACATTGTGCCAGG + Intronic
1001956574 5:175851787-175851809 CACATCTGGAACCTAGTCCCTGG - Intronic
1003376397 6:5581697-5581719 CACATCAGGAATTAAGGGCCTGG - Intronic
1004805675 6:19201555-19201577 AACAGCTTGAACCATGTGCCTGG - Intergenic
1007627965 6:43257185-43257207 CACCTCCTGAACCCAGGGCCTGG + Intronic
1008990709 6:57598589-57598611 AAAATCATCAACCAAGGGCCCGG + Intronic
1009051629 6:58283124-58283146 AACAGCTTGAACCATGTGCCTGG + Intergenic
1009179283 6:60497136-60497158 AAAATCATCAACCAAGGGCCCGG + Intergenic
1009377504 6:62990709-62990731 AACAGCTTGAACCATGTGCCTGG - Intergenic
1011378603 6:86718671-86718693 AACAGCATGCACCATGTGCCTGG - Intergenic
1013146952 6:107403405-107403427 GACAACTTGAACCATGTGCCTGG - Intronic
1013980731 6:116125436-116125458 CACTCCATGAACCAAGTTCAAGG + Exonic
1015548942 6:134392178-134392200 CAGATCATGATCCTACTGCCTGG - Intergenic
1015554950 6:134451689-134451711 CACCCCATGCACCAAGTGGCTGG - Intergenic
1019849189 7:3537713-3537735 CACATCAAGAGTCAAGTTCCTGG - Intronic
1019987994 7:4672140-4672162 CACACCATGCACCATGTGCTGGG - Intergenic
1021596058 7:22318309-22318331 CACATCAAGAATAAAGTGACTGG - Intronic
1021923750 7:25514565-25514587 CACATCACTACCCAATTGCCTGG + Intergenic
1023679850 7:42674246-42674268 CACATCATATACCTAGTGCTAGG - Intergenic
1030504233 7:110399358-110399380 GACATCATGAGGCAAGCGCCAGG + Intergenic
1031454372 7:121961245-121961267 CAGATTATGATCCATGTGCCTGG - Intronic
1033646307 7:143307254-143307276 ACCATCATGTACCAAGTGCTTGG + Exonic
1034750327 7:153562243-153562265 TAGATCATAAACCAGGTGCCGGG - Intergenic
1035062736 7:156081205-156081227 CACAGGAAGAACCAAGTGCCAGG + Intergenic
1038534916 8:28347051-28347073 AACATCATGACCCTACTGCCAGG + Exonic
1038622890 8:29161372-29161394 CACTGCATGAAACAAGTTCCAGG + Intronic
1041465402 8:58153469-58153491 CACATCAGGACCCAAGTTTCTGG + Intronic
1046880160 8:119298977-119298999 GACAGCTTGGACCAAGTGCCTGG - Intergenic
1049368826 8:142253805-142253827 CACAACATGGGCCACGTGCCGGG - Intronic
1051880401 9:21834165-21834187 GACAACATGAAGCAAGTGCTTGG - Intronic
1053607706 9:39678356-39678378 CACATCCATGACCAAGTGCCTGG - Intergenic
1053865554 9:42434723-42434745 CACATCCATGACCAAGTGCCTGG - Intergenic
1054245829 9:62664053-62664075 CACATCCATGACCAAGTGCCTGG + Intergenic
1054559954 9:66698584-66698606 CACATCCATGACCAAGTGCCTGG + Intergenic
1054712624 9:68526311-68526333 CCCATCCTGAGCCAAGAGCCTGG - Intronic
1059946614 9:119415051-119415073 CACAGCAGGCACCCAGTGCCTGG - Intergenic
1186961497 X:14741554-14741576 CACAAGAAGCACCAAGTGCCAGG + Intergenic
1188198895 X:27275475-27275497 CACATCATGTAAAAAGTGCTTGG - Intergenic
1189726714 X:43974853-43974875 ATCATCATCAGCCAAGTGCCAGG - Intergenic
1194905986 X:99576665-99576687 CACAGATTGCACCAAGTGCCTGG + Intergenic
1195625941 X:107005935-107005957 CCCATGCTGAACCAACTGCCAGG - Intergenic