ID: 1167785172

View in Genome Browser
Species Human (GRCh38)
Location 19:51630114-51630136
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 920
Summary {0: 2, 1: 0, 2: 11, 3: 91, 4: 816}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167785156_1167785172 24 Left 1167785156 19:51630067-51630089 CCCGGAACCAGTAGACGTAGAGT 0: 2
1: 0
2: 0
3: 0
4: 49
Right 1167785172 19:51630114-51630136 CAGGGGTAAGAGAAGGAGCAGGG 0: 2
1: 0
2: 11
3: 91
4: 816
1167785157_1167785172 23 Left 1167785157 19:51630068-51630090 CCGGAACCAGTAGACGTAGAGTG 0: 2
1: 0
2: 1
3: 5
4: 43
Right 1167785172 19:51630114-51630136 CAGGGGTAAGAGAAGGAGCAGGG 0: 2
1: 0
2: 11
3: 91
4: 816
1167785153_1167785172 30 Left 1167785153 19:51630061-51630083 CCCCGTCCCGGAACCAGTAGACG No data
Right 1167785172 19:51630114-51630136 CAGGGGTAAGAGAAGGAGCAGGG 0: 2
1: 0
2: 11
3: 91
4: 816
1167785155_1167785172 28 Left 1167785155 19:51630063-51630085 CCGTCCCGGAACCAGTAGACGTA 0: 2
1: 0
2: 1
3: 4
4: 30
Right 1167785172 19:51630114-51630136 CAGGGGTAAGAGAAGGAGCAGGG 0: 2
1: 0
2: 11
3: 91
4: 816
1167785162_1167785172 17 Left 1167785162 19:51630074-51630096 CCAGTAGACGTAGAGTGGGGGAG 0: 2
1: 0
2: 0
3: 7
4: 51
Right 1167785172 19:51630114-51630136 CAGGGGTAAGAGAAGGAGCAGGG 0: 2
1: 0
2: 11
3: 91
4: 816
1167785154_1167785172 29 Left 1167785154 19:51630062-51630084 CCCGTCCCGGAACCAGTAGACGT 0: 2
1: 0
2: 0
3: 3
4: 18
Right 1167785172 19:51630114-51630136 CAGGGGTAAGAGAAGGAGCAGGG 0: 2
1: 0
2: 11
3: 91
4: 816

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900151496 1:1181012-1181034 CAGGGGCAAGGGCAGGGGCAGGG - Intronic
900166094 1:1244908-1244930 GAGGGGGAAGAGGAGGAGGAGGG - Intronic
900787902 1:4660305-4660327 CAGGGGTCAAAGAAGGAGTGGGG + Intronic
901736647 1:11316742-11316764 CAGGGGCAAGAGAAGGAGAGAGG - Intergenic
901902823 1:12380591-12380613 CAGGGGTCTGAGAAGTAGGAAGG + Intronic
902119298 1:14148277-14148299 CAGGGATGAGAGGAGAAGCAGGG - Intergenic
902205252 1:14863747-14863769 CAGGGGAAACTGAAGGTGCACGG + Intronic
902600796 1:17539434-17539456 CCGGGGTAGGTGAAGGAGCGAGG + Intergenic
902606342 1:17571409-17571431 CAGGGACAGGAGACGGAGCATGG + Intronic
902699825 1:18164275-18164297 AAGGGGAGAGGGAAGGAGCAAGG - Intronic
903189268 1:21647708-21647730 CTGGGGTAGGGGAAAGAGCATGG - Intronic
903269201 1:22177232-22177254 CAGGGGAGGGACAAGGAGCAAGG + Intergenic
903653393 1:24934402-24934424 GAGGGGAGGGAGAAGGAGCAAGG + Intronic
904321239 1:29698896-29698918 CAGGGGCAGGGGCAGGAGCAGGG - Intergenic
904566217 1:31429799-31429821 GTGGGGTCAGGGAAGGAGCATGG + Intronic
904948233 1:34214819-34214841 GAGGGTGAGGAGAAGGAGCAGGG + Intronic
905943888 1:41885710-41885732 GAGGGGGAAGGGAAGGAGGAAGG - Intronic
906477878 1:46182034-46182056 GAGGGGTAGAAGAAGGGGCAAGG + Intronic
906592171 1:47035597-47035619 CAGCGGAGTGAGAAGGAGCATGG - Intronic
906948508 1:50315858-50315880 CAGGGGTGCGAGGAGGAGCTTGG - Intergenic
907195601 1:52684072-52684094 CAGGAGCAAGAGAGTGAGCAAGG - Intergenic
907405536 1:54251491-54251513 CAGGGGTGAGAGGAAGGGCATGG - Intronic
907520154 1:55018561-55018583 CAGGGCTATGACAAGGAGGAAGG + Intergenic
907564355 1:55420976-55420998 CAGGGGTAAGTGAAAGGTCAGGG + Intergenic
907629848 1:56069526-56069548 CAGTGGAAAGAGCAGGAGCAAGG + Intergenic
907787286 1:57625240-57625262 CAGGAGTAGAAGAAGGAGGAGGG - Intronic
908144710 1:61227615-61227637 CAGGGGTTAGAGAAGTAGTGGGG - Intronic
908528265 1:65008670-65008692 AAGGAGAAAGAGAAGGAGAAGGG - Intergenic
908769970 1:67587067-67587089 CAATGGTAAGAGTAGGAGGATGG - Intergenic
908887710 1:68809222-68809244 CAAGGGTATGAGATGAAGCAAGG + Intergenic
909458571 1:75879701-75879723 CAGGGGTCAGAGATGGAGTGAGG + Intronic
909668870 1:78165852-78165874 CAGGGGTCACGGTAGGAGCATGG - Intergenic
909694421 1:78450056-78450078 CAGGTGCAACAGAAGCAGCATGG - Intronic
910009222 1:82439876-82439898 AAGAAGTATGAGAAGGAGCAGGG + Intergenic
910160880 1:84271036-84271058 CAGGGACAAGGGAAGAAGCAGGG + Intergenic
910731145 1:90398766-90398788 CAGGAGAGAGAGAGGGAGCAAGG + Intergenic
911374557 1:97036064-97036086 GAGGGGTAAGAGGAAAAGCATGG + Intergenic
911513053 1:98831622-98831644 TAGGGGTAGGAGAAGGAGATTGG - Intergenic
911630212 1:100174995-100175017 CAGGAGCAAAAGAGGGAGCAGGG - Intronic
912153921 1:106892440-106892462 CAGAGGTAGGAGTAGGAGCTGGG - Intergenic
912691505 1:111808149-111808171 CAGGCGTTAGACAAGGTGCATGG - Intronic
913109712 1:115647002-115647024 CTGGGGCTAGAGAAGGAGGAGGG + Intronic
913185213 1:116364478-116364500 CAGTGGAAAGAGAAGGGGCTGGG + Intergenic
913509688 1:119550450-119550472 CAGGAGAAAGAGAAGGCGCACGG + Intergenic
914382487 1:147130065-147130087 CACGGCTAAGTGCAGGAGCAAGG - Intergenic
915534713 1:156528411-156528433 CGGGTGGAAGAGAAGAAGCATGG - Intronic
915702285 1:157807304-157807326 CAGGGGTAAGATAAGGAGGGAGG - Intronic
916273250 1:162966861-162966883 CGGGGGAAAGAGTAGAAGCAAGG + Intergenic
916382210 1:164224530-164224552 CAGGGGGAAGGGCAGGAGGAAGG + Intergenic
916451402 1:164923945-164923967 GAGGGGGAAGACAAGGAGCAGGG + Intergenic
916745006 1:167678474-167678496 CAAGGGAAAGAGAAGAATCATGG - Intronic
916762882 1:167832969-167832991 CCAGGGTAAGGGAAGGAGCTGGG - Exonic
916984582 1:170177110-170177132 CTGGGGTAAGAATAGAAGCAAGG + Intergenic
917165684 1:172110124-172110146 CAGGGGCAAGAGAAGGAACAGGG - Intronic
917186733 1:172364828-172364850 CAGTAGCAAGAGAGGGAGCAGGG - Intronic
917771532 1:178284987-178285009 GATAGGTAAGAGAAGGAACAGGG - Intronic
917929411 1:179813312-179813334 CAGGCGTAAGTCAAGGAGGATGG + Intronic
917975833 1:180237089-180237111 CAGGGGAAGGAGAAGGAGGGAGG - Intronic
918008867 1:180567762-180567784 CTGGGGTGAGAGAAGGAAAATGG - Intergenic
918039146 1:180901655-180901677 CAGCTGTAAGAGAAGGAGGCAGG + Intergenic
919817939 1:201453458-201453480 TAGGGGTAAGAGAAGAACCCTGG + Intergenic
919972163 1:202588117-202588139 CAGGGCAAAGACAAGGAGGAAGG - Exonic
920037186 1:203073839-203073861 CTAGGGTAAGAGCAGGATCATGG + Intronic
920166457 1:204039674-204039696 CAGGAGGAAGAGAGAGAGCAGGG - Intergenic
920415178 1:205794830-205794852 CAGGGGCATGGGAAGGAGCCAGG - Intronic
920435848 1:205946628-205946650 CAGCGGACAGAGAAGGAGCCGGG + Intergenic
920657581 1:207888012-207888034 CAGGGGTGGGAGAAGGGGGAGGG + Intronic
920805039 1:209224968-209224990 AAAGGGAAAGAGAAGGAGAATGG - Intergenic
920849340 1:209618048-209618070 CCTGGGTGAGAGAAGCAGCAGGG + Exonic
920860126 1:209699106-209699128 CAGGAGGAAGGGAAGGAGGAGGG + Intronic
921035588 1:211375522-211375544 CAGAGGTAAGAGAAACACCAAGG + Intergenic
921417658 1:214909254-214909276 CAGGAGGAAGAGAAGGAAGAAGG + Intergenic
921687026 1:218101735-218101757 CAGGGGAAGGAAAAGGAGAAAGG + Intergenic
921736659 1:218635746-218635768 GAGGGGAGAGAGAAGGAGCGGGG + Intergenic
922128067 1:222748839-222748861 CAGGGGTAAGAGAAGGCTGTCGG + Intronic
922187975 1:223293206-223293228 TAGGGGTAAGAGGAGGAGGAAGG - Intronic
922326777 1:224535705-224535727 CAGGGGTGAGGGAAGCACCAAGG + Intronic
922744497 1:228036669-228036691 CAGGGGACAGAGAAGCTGCACGG - Intronic
922747340 1:228051847-228051869 CATGGGCCAGAGCAGGAGCAAGG + Intronic
922874338 1:228928149-228928171 CTGGGGGAAGAGAGGGAGCCCGG + Intergenic
923056360 1:230428437-230428459 CTGTGGTAAGAGAAGGAGTGAGG + Intergenic
923339439 1:232995168-232995190 CGGGGGGCAGAGAAAGAGCAGGG + Intronic
923482570 1:234397715-234397737 GAGGGGGAAGAGAGGGAGGAGGG + Intronic
923570620 1:235110305-235110327 CAGGGGTGGGAAAGGGAGCAAGG - Exonic
923673228 1:236059167-236059189 CAAGTGTAACAGAAAGAGCACGG - Intronic
924043483 1:240006285-240006307 CAGAAGAAAGAGAAGAAGCATGG - Intergenic
924258247 1:242203618-242203640 CAGTGGCAAGAGAGGGAGCAAGG - Intronic
924903724 1:248429982-248430004 CAAGGGAAAGAGAAGCACCAGGG - Intergenic
924924147 1:248662018-248662040 CAAGGGAAAGAGAAGCACCAGGG + Intergenic
1062944357 10:1449316-1449338 CACGGGGAAGTGAAGGGGCACGG - Intronic
1063121346 10:3106997-3107019 CAGGGGTGAGAGGAGGGGCAGGG - Intronic
1063675590 10:8138515-8138537 CAGGGGACAGAGAAGGGGCCTGG - Intergenic
1063938927 10:11107719-11107741 CAGGAATGAGAGAAGGAACAAGG - Intronic
1064121741 10:12624958-12624980 AAGGAGGAAGAGAAGGAGAAGGG - Intronic
1064394805 10:14973354-14973376 CAGGGGCAAGAGAAAGACCTTGG - Intronic
1064559184 10:16578871-16578893 TAGGGGTGAGAGAGGGAGTAGGG + Intergenic
1064564160 10:16623173-16623195 CAGGTGGGAGAGAGGGAGCAAGG - Intronic
1064961908 10:20974452-20974474 CAGGAGTTCGAGAAGCAGCATGG - Intronic
1065169295 10:23010807-23010829 GAGAGGCAAGGGAAGGAGCAGGG - Intronic
1066431610 10:35357166-35357188 CAGGGGCAGGGGCAGGAGCAGGG - Intronic
1066753367 10:38683435-38683457 TAGGGGGAAGAGTAGGAGGAGGG + Intergenic
1067024841 10:42836080-42836102 CAGGGGCCAGAGCAGCAGCAAGG - Intergenic
1067461958 10:46464948-46464970 GAGAGATCAGAGAAGGAGCAGGG + Intronic
1067466065 10:46500126-46500148 CTGGATTATGAGAAGGAGCAGGG + Intergenic
1067621123 10:47884480-47884502 CTGGATTATGAGAAGGAGCAGGG - Intergenic
1067625237 10:47919650-47919672 GAGAGATCAGAGAAGGAGCAGGG - Intergenic
1067935446 10:50608339-50608361 GAGGGGAAAGAGAAGGAAAAGGG + Intronic
1068687734 10:59886781-59886803 AATGGGTAAGAGAAAGACCAAGG + Intronic
1070415697 10:76187375-76187397 CAAGGGAAAGGAAAGGAGCAAGG - Intronic
1070509468 10:77147426-77147448 CAGGGGGAAGGGAAGGAGGGAGG - Intronic
1070539559 10:77406419-77406441 CAGGGGCACGAGAAGAAGCAAGG - Intronic
1070882376 10:79861358-79861380 CAGAGGTAGGAGGAGGAGCTGGG - Intergenic
1071147093 10:82588352-82588374 CAGGGGCAAGAGAAGGAGGCAGG - Intronic
1071648946 10:87377669-87377691 CAGAGGTAGGAGGAGGAGCTGGG - Intergenic
1071877761 10:89861320-89861342 GAGGGGGAAGAGGAGGAGTAGGG - Intergenic
1071877793 10:89861436-89861458 GAGGGGGAAGAGGAGGAGGAGGG - Intergenic
1072295882 10:94009228-94009250 CAGGGGCAAGAGACAGAGAAGGG + Intronic
1072314355 10:94187628-94187650 CAAGGGCCAGGGAAGGAGCAGGG + Intronic
1072439280 10:95439409-95439431 CAAGGGCCAGAGAAGGAGGAAGG - Intronic
1072608348 10:97001420-97001442 CAGGAGGAAGAGGAGGAGGAGGG + Intronic
1072904458 10:99439535-99439557 CAGGGGTGGGAGTAGGAGGAAGG + Intergenic
1072950435 10:99842226-99842248 CATGGGTAAAAGATGGAGCCAGG - Intronic
1073053433 10:100684034-100684056 CAGGGGGGAGGGGAGGAGCAGGG + Intergenic
1073091132 10:100940773-100940795 CAGGGGCAGGAGCAGGGGCAGGG - Intronic
1073522820 10:104150473-104150495 CAGGGTTAAGGGAAACAGCAAGG - Intronic
1073826714 10:107332222-107332244 CATGGGGAAGGGAAGGAGGAAGG - Intergenic
1073956021 10:108872309-108872331 GAGAGGTAAGGGAAGGAGGAGGG + Intergenic
1074156738 10:110806436-110806458 CAGGAGTTAGAGTGGGAGCAGGG + Intronic
1074405385 10:113176797-113176819 CAGGGGAAGGAGAAGCAGCCAGG - Intergenic
1074530876 10:114297837-114297859 CAGGGTTAACAGGAGGAGCCAGG - Intronic
1074944124 10:118264704-118264726 TAGCAGGAAGAGAAGGAGCAGGG + Intergenic
1075076303 10:119352935-119352957 CAGGGGAGAGAGAGGGAGGACGG - Intronic
1075212405 10:120502345-120502367 AAGGGGGAAGAGAAGGAGGGAGG + Intronic
1075724585 10:124604881-124604903 CAGGGGCAGGGGAAGGGGCAGGG - Intronic
1076178777 10:128389420-128389442 CAGAGGGAAGAGAAGGTGCGAGG + Intergenic
1076318900 10:129564261-129564283 GAGGGGGAAGAGGAGGAGGAAGG - Intronic
1076318956 10:129564419-129564441 GAAGGGGAAGAGAAGGAGCAAGG - Intronic
1076928512 10:133508972-133508994 CAGGAGGAAGAGAGGGAGAAAGG + Intergenic
1077235844 11:1481703-1481725 CAGGGGCAGGAGCAGGGGCAGGG + Intronic
1077874677 11:6294111-6294133 CAGGGGCAGGGGAAGGGGCAGGG + Intergenic
1077902749 11:6502941-6502963 CAGGGGGAGGAGAAGGGGCCTGG - Intronic
1078173047 11:8944419-8944441 AAGGGGTTAGAGAAGGAGGAGGG - Intergenic
1078308012 11:10210377-10210399 GAGGAGGAAGAGAAGGAGGAAGG + Intronic
1078749219 11:14143888-14143910 CAGAGGTCAGAGAAAGAGTATGG + Intronic
1079049702 11:17143319-17143341 CAGGTGAAAGATAAAGAGCATGG - Intronic
1079309002 11:19347950-19347972 CAGGAGAAAGAGGAGAAGCAAGG - Intergenic
1080157406 11:29127913-29127935 AAGGGGAAAGGGAAGGAGAAGGG + Intergenic
1081208254 11:40300095-40300117 CAGGAGTAAGAGAGAGAGAAAGG + Intronic
1081737836 11:45416717-45416739 CATGGGGAAGAGAGGGAGGAAGG - Intergenic
1081826438 11:46058170-46058192 TGGGGGTAAGAGAAGGAGAAAGG + Intronic
1082243511 11:49893572-49893594 CAGGAGGAGGAGGAGGAGCACGG - Intergenic
1082881407 11:58041529-58041551 CAGGGCAAGGAGAAAGAGCAGGG + Intronic
1082892430 11:58154195-58154217 AAGGGGGAGGAGAAGGAGGAAGG + Intronic
1083424412 11:62575683-62575705 GAGGGGAAAGAGGAGCAGCAGGG - Exonic
1083810851 11:65105907-65105929 GAGGTGTAGGAGAAGGAGCATGG + Intronic
1084332498 11:68438224-68438246 CGGGGGTCAGAGGAGGAGGAGGG + Intronic
1084616640 11:70240794-70240816 CAGGGCTAAAAGCAGCAGCAAGG - Intergenic
1084739745 11:71131938-71131960 CAGCTGCAAGAGGAGGAGCAGGG + Intronic
1085241798 11:75062642-75062664 CAGGAGCAAGAGAGAGAGCAAGG - Intergenic
1085641421 11:78195411-78195433 AAGGGGTAGGGGAAGGAGCAGGG + Intronic
1085759978 11:79233445-79233467 CAGGGGGACGGGAAGGAGGAGGG + Intronic
1085923803 11:80990557-80990579 CAGTGCTATGAGAAGGGGCAAGG - Intergenic
1086354469 11:85980234-85980256 CAGAGGATAGAGAAGGAGGATGG + Intronic
1086916017 11:92531143-92531165 CATGGCTGAAAGAAGGAGCAAGG - Intronic
1087576524 11:99996793-99996815 CAGGAGAGAGAGAGGGAGCATGG + Intronic
1088630774 11:111772019-111772041 CAGAGGTAGGAGATGGAGGAGGG - Intergenic
1089165824 11:116475698-116475720 AAGGGGTAAGAGCAGAAGCAGGG + Intergenic
1089704309 11:120266385-120266407 CAGGGGTAAGAGAAGAGGAAGGG - Intronic
1090098749 11:123771572-123771594 CATGGGAATGAGAAGGAGAAAGG - Intergenic
1090810373 11:130235261-130235283 CAGGTGTTAGAGAAGAAGAATGG + Intronic
1090930096 11:131289935-131289957 CATGTGTAAGAGATGGAGCAGGG - Intergenic
1091192573 11:133707356-133707378 AAGGGGAAAGAGAAGGGGAAAGG + Intergenic
1091404745 12:202198-202220 CAGGGGGAAGAGCAGGTGCAGGG - Intronic
1091451528 12:575300-575322 CAGGGGTGGGAGGAGGAGCTGGG - Intronic
1091687355 12:2572826-2572848 GAGGAGGAAGAGAAGGAGGAGGG - Intronic
1091831820 12:3555491-3555513 CAGGGATCAGAGAGGGAGGAGGG + Intronic
1091883537 12:3999385-3999407 CAGGGTTAAGGGTAGGAGCCAGG + Intergenic
1091948153 12:4567823-4567845 CAGGCCTAAAAGCAGGAGCAGGG - Intronic
1091966266 12:4744859-4744881 CTTGGCTAAGAGAAGTAGCATGG + Intronic
1092180458 12:6443273-6443295 AGGGGGTCAGAGCAGGAGCAGGG - Intergenic
1092387912 12:8050410-8050432 CAGGGAAGAGAGAAGGAGGATGG + Intronic
1093654151 12:21675702-21675724 TAGGAGGAAGAGAAGGAGGAGGG - Intronic
1093935216 12:24993711-24993733 CAGGGTTAAGGGAAACAGCATGG + Exonic
1094125519 12:27018878-27018900 CAGGAGGGAGAGAAGGAGGAAGG + Intergenic
1094577234 12:31698473-31698495 CCAGGCTAACAGAAGGAGCATGG - Intronic
1095323971 12:40864490-40864512 CAGGGGTAAGAGGAGGGGATGGG - Intronic
1096085217 12:48861151-48861173 GAAGGGTAGGAGAAGGAGGAAGG + Intronic
1096156577 12:49344823-49344845 CTGGAGTAGGAGAAGGAGGAGGG + Intergenic
1096395664 12:51264390-51264412 CAGGGGCAGAGGAAGGAGCATGG + Intronic
1096504622 12:52084920-52084942 CAGGGGTAAGAAGAGGGCCAGGG + Intergenic
1096678948 12:53242151-53242173 CGGGGGCAAGAGCAGGTGCAGGG - Intergenic
1097241511 12:57578680-57578702 CAGGGAGATGAGAAGAAGCAAGG + Intronic
1097331675 12:58338457-58338479 GAGGGGTAAGGAAAGAAGCAGGG - Intergenic
1098303235 12:69075819-69075841 CAGGGGGAAGAGGAGGATAATGG + Intergenic
1098407349 12:70140505-70140527 CAAGGGAAAGAGAAAGGGCAAGG - Intergenic
1098435239 12:70461512-70461534 CAGGGGGAAGAGAGGGAGTGGGG - Intergenic
1098512896 12:71339794-71339816 GAGCGGGAAGAGAAGGAGGAGGG + Intronic
1098701321 12:73631222-73631244 GAGGTGGAAGAGAAGGAGGAGGG + Intergenic
1098840470 12:75471530-75471552 AAGGGCAAAGAGAAGCAGCATGG + Intergenic
1098852749 12:75616962-75616984 CAGGGGAATGAGTAGGAGGAGGG + Intergenic
1099851474 12:88102443-88102465 CAGGGGTAAGAGAAAGGGATGGG + Intronic
1099868076 12:88309543-88309565 GAGGAGAAAGAGAAGGAGGAGGG - Intergenic
1100343188 12:93701238-93701260 CAGGAGGAAGAGGAGGAGAAGGG - Intronic
1100515654 12:95325127-95325149 CAGGGATAGGGGAGGGAGCACGG - Intergenic
1100961653 12:99968850-99968872 CAGGGGCAAGAGAGAGAGCAGGG - Intronic
1101234849 12:102778150-102778172 GAGGAGAAAGAGAAGGAGAAGGG - Intergenic
1101408918 12:104453332-104453354 CCTGGGAAAGAGAAGGAGGAAGG - Intergenic
1101731360 12:107429025-107429047 CAGGGGAAAGAGAGGGAGAGAGG + Intronic
1101785977 12:107884011-107884033 CAGGGATAACGGAAGGAGGAAGG - Intergenic
1102420512 12:112799677-112799699 CAGGGGTTAGGGAAGGTGAAGGG - Intronic
1102940260 12:116934964-116934986 CAGGGGTTAGAGATGGAGCTGGG - Intronic
1103037339 12:117667198-117667220 CAGGGGAAAGAGCAGGAACTGGG + Intronic
1103568295 12:121828094-121828116 CAGGGGCAGGAGCAGGGGCAGGG - Intronic
1103581624 12:121919706-121919728 CAGGAATACGAGAAGAAGCAGGG - Intronic
1103912923 12:124362147-124362169 CCGGGGCAAGAGCAGGAGCCCGG - Exonic
1104846123 12:131847870-131847892 CAGGGGACAGAGGGGGAGCAGGG - Intronic
1105353828 13:19639691-19639713 CAGGGGTAAGAGAGGAGGGAAGG + Intronic
1106196410 13:27497912-27497934 CAGAAGTAAGAGACGGGGCAAGG - Intergenic
1106463424 13:29992281-29992303 CAGGAGCAAGAGAATGAGAAGGG - Intergenic
1107838188 13:44429082-44429104 CAGTGGAAGGAGAAGGAGCCTGG + Intergenic
1107904519 13:45049965-45049987 AAGGGGTAACTGAGGGAGCAAGG - Intergenic
1108856874 13:54803509-54803531 CAGGGTTAAGAGAAGTGACATGG - Intergenic
1108874523 13:55028477-55028499 TAAGGGAAAGAGAAAGAGCAAGG + Intergenic
1109617766 13:64859152-64859174 CAGGGGAAAGAGTGGGAGTAGGG - Intergenic
1109718905 13:66252317-66252339 GAAGGGAAAGAGAAGAAGCAGGG + Intergenic
1110240628 13:73262501-73262523 CAGGAGGAAGAGAGAGAGCAAGG + Intergenic
1110281402 13:73698193-73698215 GAGGGGAAAGGGAAGGAGGAGGG + Intronic
1110413959 13:75232295-75232317 CAGAGGGAACAGAAGGTGCATGG - Intergenic
1110810090 13:79803090-79803112 GAGGGGAAAGAGAACCAGCAGGG + Intergenic
1111294137 13:86257699-86257721 CAGGGGTAAGAGGCAGAGAAAGG - Intergenic
1111317943 13:86585539-86585561 CAGGAGGAAGAGAGGGAGAAAGG - Intergenic
1111714482 13:91862967-91862989 AAGGGGAAAGAGAAGGAGAAAGG - Intronic
1112122220 13:96425669-96425691 CAGGGCTATGGGAAGGAGTAGGG - Intronic
1112235769 13:97634862-97634884 CAGGAGCAAGAGAGAGAGCAAGG + Intergenic
1112593068 13:100782350-100782372 CAGGGGTAAGCAATGGGGCAAGG - Intergenic
1112724086 13:102282037-102282059 CAGGGTTAGGAGAAGCGGCAAGG - Intronic
1113062502 13:106338311-106338333 CAGGAGCAAGAAAGGGAGCAGGG - Intergenic
1113375194 13:109758936-109758958 AAGGGGAAAGGGAAGGAGAAGGG + Intronic
1113535764 13:111065097-111065119 CATGGGTAAGAGAAGGCCCATGG + Intergenic
1114407538 14:22470771-22470793 CAGGGACAAGAGCAGAAGCAAGG - Intergenic
1115762536 14:36589874-36589896 CAGGGTGAAGGGAAGGAGGAAGG + Intergenic
1116680568 14:47964484-47964506 CAGGAGCAAGAGAAGAAGCCTGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117315395 14:54567038-54567060 GAGGAGTAAGAGGAGGAGGAAGG + Intergenic
1117354142 14:54907149-54907171 CAGGGGGCAGAGAAACAGCATGG + Intergenic
1117520227 14:56544188-56544210 AATGGGTAATAGAAGAAGCAAGG - Intronic
1118095111 14:62527716-62527738 CAGGGGTTAGAGAATAAGAAGGG + Intergenic
1118201672 14:63679870-63679892 CAGGAGGAAGAGAAGGTGAAGGG + Intergenic
1118294575 14:64557408-64557430 AAGGGGAAAGAGAAGGAGAAGGG + Intronic
1118424936 14:65650474-65650496 CAGGAGCAAGAGAGAGAGCAGGG + Intronic
1118841389 14:69515680-69515702 CAGGAGCAAGAGAGAGAGCATGG + Intronic
1118851022 14:69583642-69583664 CAGGCAGAAGAGAGGGAGCAGGG - Intergenic
1118906025 14:70023856-70023878 TAGGGGTAGGAGTAGGGGCAGGG + Intronic
1119123144 14:72098332-72098354 CAGGGGACAGAGAAAAAGCAAGG - Intronic
1119180384 14:72601044-72601066 AAGGGGGAAGAGGAGGAGGAGGG + Intergenic
1119557410 14:75564331-75564353 CAGGTGCAAGAGAAGCATCAGGG - Intergenic
1119763915 14:77175998-77176020 CAGGGGTAAGAGAGGGCAGAGGG + Intronic
1119970262 14:78962395-78962417 CAGGGGAAAGAGAAGTAACTGGG - Intronic
1120516951 14:85482098-85482120 CAAGGGGAAGAAAGGGAGCAGGG + Intergenic
1121288250 14:92753388-92753410 CAGGAGGAAGAGAGAGAGCAGGG - Intergenic
1121408119 14:93731622-93731644 AATGGGGAAGAGAAGGAGAAAGG - Intronic
1121777260 14:96598892-96598914 CAGGGGAAAGTGGAGCAGCAGGG - Intergenic
1122318439 14:100839341-100839363 CAGGGCTCAGAGAAACAGCAGGG - Intergenic
1122392789 14:101401803-101401825 AAGAGGAAAGAGAAGGAGAAGGG - Intergenic
1122831110 14:104396353-104396375 CAGGGGTCAGAGCAGGGCCAAGG - Intergenic
1123189252 14:106552049-106552071 CAGGAGAGAGAGAAAGAGCAAGG - Intergenic
1123678642 15:22739478-22739500 AAGGGGGAAGGGAAGGAGAAAGG - Intergenic
1123736377 15:23188189-23188211 AAGGGGAAAGCGAAGGAGAAAGG - Intergenic
1123779869 15:23615579-23615601 CAGAGGTAAGAGAAGCACCGAGG - Intronic
1123988387 15:25665198-25665220 CAGGGCAAAGACAAGGACCAAGG + Intergenic
1124287083 15:28411166-28411188 AAGGGGAAAGCGAAGGAGAAAGG - Intergenic
1124295618 15:28500463-28500485 AAGGGGAAAGCGAAGGAGAAAGG + Intergenic
1125306205 15:38318577-38318599 CAGGGGAAAGAGAAGGAGGGAGG - Intronic
1126408745 15:48350004-48350026 CGGGGGGAAGAGTGGGAGCAGGG + Intergenic
1127504093 15:59581574-59581596 CTGGGGTAAGACTAGAAGCAAGG - Intergenic
1127767730 15:62203898-62203920 AAGGGGGAAGAGAAGGAGAGGGG - Intergenic
1128770320 15:70277119-70277141 CAGGGGTTACAGAAAGAGCGTGG - Intergenic
1128779730 15:70351494-70351516 CAGTGGCAAGAGGAGAAGCAGGG - Intergenic
1128867417 15:71125107-71125129 AAGGGGAAAGGGAAGGAGAAAGG + Intronic
1129165434 15:73774591-73774613 CAGGGGTGAGAGGAGGTGGACGG - Intergenic
1129181704 15:73881976-73881998 CAGGGGTAAGAGGAGTGGCTGGG - Intronic
1129393380 15:75231721-75231743 CAGGGGTGGGAGAGGGAGAAGGG - Intergenic
1129497344 15:75997728-75997750 CAGGGCCAAGAGATGGAGAAGGG - Intronic
1129923747 15:79343630-79343652 CAGGGGTAAGAGTGGATGCAGGG + Intronic
1130681593 15:86001647-86001669 AAAGGGAAAGAGAAAGAGCAGGG - Intergenic
1131105551 15:89731643-89731665 CAGAGGTAACAGAAGGCCCAGGG - Intronic
1131112988 15:89776895-89776917 CAGGGGCAAGGGCAGGGGCAGGG + Exonic
1131112998 15:89776919-89776941 CAGGGGCAAGGGCAGGGGCAAGG + Exonic
1131117863 15:89805578-89805600 CGGGGGTGGGAGCAGGAGCAGGG - Intronic
1131463974 15:92639758-92639780 CAGGAGCAAGAGAAAGAGCAAGG - Intronic
1131714712 15:95095801-95095823 AAAGAGGAAGAGAAGGAGCAAGG + Intergenic
1132106490 15:99066604-99066626 CAGGGCTGAGAGAAGGACCCAGG - Intergenic
1132806103 16:1775859-1775881 CAGTGGCAAGAGACGGCGCAGGG + Exonic
1133513707 16:6485332-6485354 GAGGGGTAAGAGAGGGAGGGAGG - Intronic
1133590062 16:7233420-7233442 CATGAATAAGAGAAAGAGCAAGG - Intronic
1133833466 16:9345610-9345632 CAAGGGGAAGAGAAGTAACAGGG - Intergenic
1134023696 16:10939284-10939306 GAGGGGTAAGAGGGGAAGCAGGG - Intronic
1134692038 16:16197493-16197515 CAGAGGGAAGAGAGGGAGGACGG + Intronic
1134912222 16:18037978-18038000 CACAGGTGAGAGAGGGAGCAAGG - Intergenic
1135028157 16:19014599-19014621 CAGGGGAAAGAGAAGGTGCTGGG - Intronic
1135124609 16:19798039-19798061 CAGGGGTAAGAGGCAGAGAAAGG + Intronic
1135795975 16:25442876-25442898 AAGGAGAAAGAGAAGGAGAAGGG - Intergenic
1136729340 16:32393556-32393578 TAGGGGGAAGAGTAGGAGGAGGG - Intergenic
1137399651 16:48142958-48142980 CAGGGAGTAGAGCAGGAGCATGG + Intronic
1138299262 16:55912612-55912634 GAGGAGGAAGAGAAGGAGCAGGG + Intronic
1138311508 16:56027412-56027434 CAGATGTAAGAGAATGAGCCTGG - Intergenic
1138332472 16:56226134-56226156 GAGGGGCAAGAGAGGGAGCAGGG + Intronic
1138560894 16:57800480-57800502 AATGGGCAAGGGAAGGAGCAAGG + Intronic
1138835410 16:60428870-60428892 GAAGGGAAAGAGAAGGAGGATGG + Intergenic
1138902708 16:61294227-61294249 CAGGGGTTAGAAGTGGAGCAGGG - Intergenic
1139582119 16:67879978-67880000 CAAGGGTCAGAGATGGAGGATGG + Intronic
1139910075 16:70392231-70392253 CAAGGGAAAGGGAAGGAACATGG + Intronic
1140136439 16:72210040-72210062 CAGGGGTATGAGAACAAGCAAGG - Intergenic
1140199620 16:72884629-72884651 CAGGAGGAGGAGAAGGAGAAAGG + Intronic
1140716086 16:77726963-77726985 CAGGAGCAAGAGAGAGAGCAGGG + Intronic
1140775838 16:78248275-78248297 CAGGAGCAAGAGAGGGAGCAAGG + Intronic
1140781818 16:78303849-78303871 CAGTGGTGGGAGAAAGAGCACGG - Intronic
1141492694 16:84385234-84385256 CAGGAGCAAGAGAGAGAGCAGGG + Intronic
1141498404 16:84426227-84426249 CAGGGGCAGGAGAGGGAGGAAGG + Intronic
1141929598 16:87193148-87193170 CAGGGGTTAGGGAAGGGGCGTGG - Intronic
1202997056 16_KI270728v1_random:123965-123987 TAGGGGGAAGAGTAGGAGGAGGG + Intergenic
1203023743 16_KI270728v1_random:436307-436329 TAGGGGGAAGAGTAGGAGGAGGG + Intergenic
1142582046 17:949013-949035 CAGGGGGGAGAGGAGGAGCCCGG - Intronic
1142676972 17:1519686-1519708 CAAAGGGAAGAGGAGGAGCAGGG + Exonic
1143407024 17:6684394-6684416 CATGGCTAGCAGAAGGAGCAGGG + Intergenic
1143628037 17:8122083-8122105 CAGGGGTGAGGGAAGGGGCGGGG + Intronic
1144212309 17:13025855-13025877 GAGAGGGAAGAGAGGGAGCAAGG - Intergenic
1144244068 17:13345871-13345893 CAGGGTGAAGAGAAGGGGAATGG + Intergenic
1144874796 17:18391836-18391858 CAGGGGGCAGAGGAGGAGCATGG - Intergenic
1145157429 17:20552585-20552607 CAGGGGGCAGAGGAGGAGCATGG + Intergenic
1145799841 17:27675932-27675954 CAGGGGGCAGAGGAGGAGCATGG + Intergenic
1146159363 17:30551666-30551688 CAGGGGGCAGAGGAGGAGCATGG - Intergenic
1146348440 17:32076199-32076221 AAGGAGCAAGAGAAAGAGCAGGG - Intergenic
1146570079 17:33944895-33944917 CAGGGGTGAGGGAAGCAGAAAGG - Intronic
1146619882 17:34389062-34389084 CAGGGAGAGGGGAAGGAGCATGG + Intergenic
1146786242 17:35724460-35724482 CAGGGGAAAGGAAAGGAGTAAGG - Intronic
1146845216 17:36178148-36178170 CAGGGGGCAGAGGAGGAGCATGG + Intronic
1146873432 17:36389991-36390013 CAGGGGGCAGAGGAGGAGCATGG + Intronic
1146880791 17:36441079-36441101 CAGGGGGCAGAGGAGGAGCATGG + Intergenic
1147065958 17:37922882-37922904 CAGGGGGCAGAGGAGGAGCATGG - Intergenic
1147413742 17:40273436-40273458 GAGGGGTAAGAGACAAAGCAAGG + Intronic
1147498753 17:40942321-40942343 GAGGGGGAAGAGAGGGAGGAGGG - Intergenic
1147538138 17:41334188-41334210 CAGGGGGCAGAGGAGGAGCATGG + Intergenic
1147555728 17:41477775-41477797 TAGAGGTCAGAGAAGGAGCAAGG + Intronic
1147555748 17:41477899-41477921 TAGAGGTCAGAGAAGGAGCAAGG + Intronic
1148150027 17:45391440-45391462 CAGGGGAAAGGGAAGGAGGCAGG + Intergenic
1148237021 17:45975813-45975835 GAGGGGTAAGAGAAACAGGAAGG + Intronic
1148788790 17:50161411-50161433 CAGGGGGAGGAGAAGCCGCACGG - Intergenic
1148871153 17:50659394-50659416 CTGGGGTAAGCGAAGGGGCTGGG - Intronic
1149490093 17:57078367-57078389 CAGGTTTCAGAGAGGGAGCATGG - Intergenic
1149848355 17:60020638-60020660 CAGGGGGCAGAAGAGGAGCATGG + Intergenic
1149861814 17:60125886-60125908 CAGGGGGCAGAAGAGGAGCATGG - Intergenic
1150086702 17:62277205-62277227 CAGGGGGCAGAAGAGGAGCATGG + Intronic
1150155871 17:62852527-62852549 CAGGGGTGAGAGGAGTGGCAGGG - Intergenic
1150507542 17:65714990-65715012 CAGGTGGAGCAGAAGGAGCAAGG + Intronic
1150628600 17:66859822-66859844 AAGGGGGAGGAGAAGGAGGAGGG - Intronic
1150918806 17:69462113-69462135 CAGGGCTATGAGATGAAGCAGGG - Intronic
1151717153 17:75836745-75836767 CAGGGCTCAGGGAAGGGGCAGGG - Intronic
1152103453 17:78315842-78315864 CAGGAGGAGGAGGAGGAGCAGGG - Intergenic
1152720923 17:81923484-81923506 CAGGCGCAAGACAAGGGGCAGGG + Intronic
1153486091 18:5599646-5599668 CAGGAGCAAGAGATAGAGCAAGG - Intronic
1155225319 18:23724892-23724914 CACAGATATGAGAAGGAGCAAGG - Intronic
1155571409 18:27197751-27197773 CAGGGGTGAGAGAGAGAACATGG + Intergenic
1156219397 18:35036502-35036524 CAGTGGTAGGAGATGGGGCAAGG - Intronic
1156469234 18:37367152-37367174 CAGGAGGAAGAGGAGGAGCTAGG + Intronic
1156812946 18:41274238-41274260 CAGGGGAAAGAGTAGCAGGAGGG + Intergenic
1157198816 18:45641903-45641925 CAGGTGTATGAGAAGGACTATGG - Intronic
1157400393 18:47382280-47382302 CCGGGGTAGGAGCAGGGGCAAGG - Intergenic
1159502803 18:69295431-69295453 CAGAAAGAAGAGAAGGAGCAAGG + Intergenic
1159733337 18:72060592-72060614 TACGGGGAAGAGAGGGAGCATGG + Intergenic
1159898604 18:74021053-74021075 CAGGAGGAAGAGAGAGAGCAAGG + Intergenic
1160032018 18:75270190-75270212 CATCAGTAAGACAAGGAGCAGGG - Intronic
1160057656 18:75499541-75499563 AAGGAGTAGGAGAAGGAGAAGGG + Intergenic
1160819718 19:1052362-1052384 GAGGGGGAAGAGGAGGAGGAGGG + Intronic
1161083960 19:2325401-2325423 CAGGGGTAAGAAGGAGAGCAGGG - Intronic
1161414749 19:4139716-4139738 CAAGGGGGAGAGAAGGAGGAGGG + Intergenic
1161509544 19:4662919-4662941 CTGGGGTAGGAGGAGGAGGAAGG - Intronic
1162053089 19:8046797-8046819 GAGGGGGAGGAGAAGGAGGAGGG - Intronic
1162552270 19:11364464-11364486 CAGGGGTAGGGGCAGGGGCAAGG - Exonic
1163117656 19:15197961-15197983 CAGGGGTAATAGAAGGGGAAGGG + Intronic
1163440871 19:17322052-17322074 CAGGGGCCAGAGTGGGAGCAGGG + Exonic
1164590751 19:29505477-29505499 CAGGGGTCAGAGGTGGAGAATGG - Intergenic
1165077274 19:33286844-33286866 CAGGGGTAAGGGAATGAGGATGG + Intergenic
1165572127 19:36784348-36784370 CAGGAGTATGATAATGAGCACGG + Intergenic
1165792930 19:38502798-38502820 CAGGGGCAGGGGGAGGAGCAGGG + Intronic
1165792933 19:38502804-38502826 CAGGGGGAGGAGCAGGGGCAGGG + Intronic
1165962546 19:39547502-39547524 CAAGGGGAAGAGAAGAAGGATGG - Intergenic
1166800850 19:45456083-45456105 CAGGGGTCAGTGAGGGGGCATGG + Intronic
1166880816 19:45929017-45929039 CAGGGGCAAGTGATGGAGAATGG - Intergenic
1167676260 19:50887929-50887951 CTGGGCTAAGAGAGGGAGCTGGG + Intergenic
1167713249 19:51125092-51125114 GAGGGGTAGGAGAAGGAGCAGGG - Exonic
1167756707 19:51417363-51417385 CGGGGGTAGGAGAAAGAGCAGGG + Exonic
1167762480 19:51458230-51458252 TGGGGGTAGGAGAAGGAGCAGGG + Exonic
1167769899 19:51508582-51508604 TGGGGGTAGCAGAAGGAGCAGGG - Intergenic
1167776957 19:51564720-51564742 CTGGGGTAGGAGAAGGAGCAGGG + Intergenic
1167785172 19:51630114-51630136 CAGGGGTAAGAGAAGGAGCAGGG + Intronic
1167787271 19:51646538-51646560 CAGGGGTAAGAGAAGGAGCAGGG + Exonic
1168251571 19:55145308-55145330 AAGGGGAAGGAGAAGGAGAAGGG + Intronic
1168287060 19:55340331-55340353 CGGGGGTGAGAGAAGGGTCAGGG - Intronic
1168347750 19:55659182-55659204 CAAGGGTGAGAGGAGGGGCACGG - Intronic
1168502624 19:56906141-56906163 TAGGGGTGAGAGAAGGATCTGGG + Intergenic
924988165 2:289036-289058 CAGGGGGAAGAGGAGGAGACGGG - Intergenic
925069548 2:956045-956067 CAGGGGTAGGGGCAGGGGCAGGG - Intronic
925345471 2:3169007-3169029 CAGGAATAAGAGAAAGAGAAGGG + Intergenic
925637112 2:5951165-5951187 CTGGGGAGAGAGAAGGAGGAAGG - Intergenic
925693509 2:6549579-6549601 CAGGAGGAAGAGAGGGAGGAAGG - Intergenic
925718950 2:6809968-6809990 CATGGGTTTGAGAAGGAGCATGG - Intergenic
925894757 2:8462832-8462854 CAGATGTCAGAGAAGGAGAAAGG + Intergenic
926305789 2:11636729-11636751 CAGGGGTAAGGGCATGGGCATGG + Intronic
926305800 2:11636753-11636775 CAGGGGCAAGGGCAGGGGCAGGG + Intronic
926377017 2:12240703-12240725 CAGAGGAAAGAGAAGGAACATGG - Intergenic
926585438 2:14680687-14680709 CAGGGGCAAGAGAAGTGGCTGGG + Intergenic
926697724 2:15782454-15782476 CAGGGGTGGGAGAGGGAGGATGG - Intergenic
926951505 2:18248481-18248503 CAGGAGCAAGAGAAAGAGGAAGG + Intronic
927001736 2:18802594-18802616 CAGGGGAAAGAAAAGGATAATGG + Intergenic
927004650 2:18835462-18835484 TTGGGGTAAGAAAAGGAGGAGGG - Intergenic
927468242 2:23352527-23352549 AAGGGGAAAGAGAGGGAGGATGG + Intergenic
927586845 2:24315762-24315784 CAGGAGAGAGAGAAGCAGCAAGG - Intronic
928026785 2:27746614-27746636 ATGGGGTAAGGGAAGGAGCATGG + Intergenic
928177850 2:29047092-29047114 CAGGCGCAAGAGATGGGGCAGGG - Intronic
928320971 2:30282554-30282576 CAGGTGACAGAGATGGAGCAAGG + Intronic
929013602 2:37472337-37472359 GAGGAGGAAGAGAAGGAGAAAGG + Intergenic
929392101 2:41481622-41481644 CAGGGGAAAGAGAATGAGGCAGG + Intergenic
929589302 2:43134692-43134714 CAGGGGCAGGGGAAGGAGCGGGG - Intergenic
929595896 2:43175633-43175655 CAGGGGCAAGAGAAGGATGGAGG + Intergenic
930084063 2:47480221-47480243 AAGGGGGAAGGGAAGGAGGAAGG - Intronic
930343859 2:50152913-50152935 GAGGGAGAAGAGAAGGAGAAAGG - Intronic
931756448 2:65378931-65378953 CAAGGGTAAGCGAATGAGAAAGG + Intronic
932818202 2:74878517-74878539 CAGGGGCAGGAGGAGGAGGAAGG - Intronic
932834448 2:75023185-75023207 CAGGGGGAGTAGAGGGAGCAAGG + Intergenic
933914643 2:86977279-86977301 CAGAAGTAATAGAAAGAGCATGG + Intronic
933977270 2:87521661-87521683 GAGAGGTATGAGAAGCAGCAAGG - Intergenic
934008350 2:87792620-87792642 CAGAAGTAATAGAAAGAGCATGG - Intronic
934185639 2:89671467-89671489 TAGGGGGAAGAGTAGGAGGAGGG - Intergenic
934229793 2:90168978-90169000 AATGACTAAGAGAAGGAGCAAGG - Intergenic
934316804 2:91929113-91929135 TAGGGGGAAGAGTAGGAGGAGGG + Intergenic
934523242 2:95032985-95033007 CAGCGGGAAGAGAAGGTGCAGGG + Intronic
934662808 2:96152328-96152350 GAGGGGCATGAGATGGAGCAGGG + Intergenic
934772405 2:96915479-96915501 TGGGGGTAAGAGCAGGAGCTTGG + Intronic
935767341 2:106381885-106381907 CAAGGGTGAGGGAAGGAGTAAGG + Intergenic
935771992 2:106433561-106433583 CAGAAGTAATAGAAAGAGCATGG - Intronic
935898055 2:107759199-107759221 AAGGGATCAGAGAAGGTGCATGG + Intergenic
935908077 2:107862384-107862406 CAGAAGTAATAGAAAGAGCATGG + Intronic
935994484 2:108754615-108754637 CAGAAGTAATAGAAAGAGCATGG + Intronic
936129867 2:109827491-109827513 CAGAAGTAATAGAAAGAGCATGG + Intronic
936214830 2:110543994-110544016 CAGAAGTAATAGAAAGAGCATGG - Intronic
936423967 2:112398557-112398579 CAGAAGTAATAGAAAGAGCATGG - Intronic
936521188 2:113212973-113212995 CAAGGGTAGGAGAAAGAGCGAGG + Intergenic
936674582 2:114700252-114700274 CAGGGGCAGGAGAAGGTGGAGGG - Intronic
936856022 2:116958163-116958185 CAGGAGGAAGAGAGAGAGCAGGG + Intergenic
937995230 2:127689508-127689530 GAAGGAAAAGAGAAGGAGCAGGG + Intergenic
938043430 2:128095425-128095447 AAGGAGGAAGAGAAGGAGGAGGG - Intronic
938129974 2:128706886-128706908 CAGAGGTAAGAGAATGAGCAGGG + Intergenic
938475534 2:131608234-131608256 CAGCAGCAAGAGCAGGAGCAAGG - Intergenic
939023366 2:136984438-136984460 CAGGAGCAAGAGAAGGAGCAAGG - Intronic
939341379 2:140899340-140899362 CATGGGTATGACAATGAGCAAGG + Intronic
940617434 2:156067123-156067145 CAGGGGAGAGGAAAGGAGCAGGG + Intergenic
940784049 2:157962972-157962994 GAGGGGGAAGAGAGGGAACAAGG + Intronic
941514452 2:166455544-166455566 GAGGGGGAAGAGAAGGGGAAGGG + Intronic
942103332 2:172607762-172607784 CAGGGGAAGGAAAAGGAGCAGGG + Intronic
942115222 2:172722094-172722116 TGGTGGTAAGGGAAGGAGCATGG - Intergenic
942471499 2:176265420-176265442 CAGGAGGAAGAGAAAGAGAAGGG - Intergenic
942487332 2:176453137-176453159 TGGGGGTGAGAGATGGAGCAAGG + Intergenic
942489412 2:176474765-176474787 GAGGGGCAAGAGTAGAAGCAGGG + Intergenic
943619980 2:190138572-190138594 CAGCTGTAAGAAAATGAGCAAGG - Intronic
944094058 2:195946726-195946748 CCGGGTGAAGAGAAGGAGGAAGG - Intronic
945522023 2:210840110-210840132 CAGGGGTAAGAGTTGGATCTTGG + Intergenic
945743670 2:213694161-213694183 AGGAGGTAAGAGAAGGAGGAGGG + Intronic
946422668 2:219573513-219573535 GAGGGGGAAGAGAAGGAGGAGGG - Intronic
946435226 2:219647230-219647252 CAGGGGTAAGAGAGAGAGGGGGG - Intergenic
946990975 2:225329059-225329081 CAGGCGGAAGAGAAAGAGTAGGG + Intergenic
947843677 2:233226662-233226684 CAGAGTTAAGAGAAGTAGCAGGG + Intronic
948036726 2:234863790-234863812 CAGGGGTCAGAGAAGCACCTGGG + Intergenic
948097987 2:235351426-235351448 TAGGGGTAAGGGAAGGGGGAGGG + Intergenic
948170199 2:235895313-235895335 CTGGGGCAAGAGCAGGGGCACGG - Intronic
948365458 2:237451844-237451866 CAGGGGTGCCGGAAGGAGCATGG - Intergenic
948462515 2:238137200-238137222 CAGGGGAAAGAGCAGGAGCAGGG + Intergenic
948833960 2:240615310-240615332 CAGGGGAAACAGACGGAGAAGGG - Intronic
949008748 2:241666768-241666790 CAGGGGAATGAGAAGTACCAGGG - Exonic
1168895749 20:1322277-1322299 CAGGAGTAGGACATGGAGCAGGG - Intronic
1169267241 20:4174214-4174236 CAGAGACAAGAGAAGGGGCAAGG + Intronic
1169939389 20:10920259-10920281 CAGGGGTAAGAAAGGGAGTTCGG + Intergenic
1169961976 20:11170512-11170534 CGGGGGAAAGAAAATGAGCAAGG - Intergenic
1170264031 20:14444992-14445014 GAGGGGCAAGAGTAGAAGCAAGG - Intronic
1170532683 20:17310074-17310096 CAGGAGCAAGAGAAAGAGCAAGG + Intronic
1170690974 20:18614814-18614836 CAGGAGGAAGGGAAGGAGGAAGG - Intronic
1171085830 20:22237438-22237460 AAGGGGAAGGAGGAGGAGCAGGG - Intergenic
1171238414 20:23546384-23546406 CAGGGTCAAGAGAAGGACCAAGG + Intergenic
1171241034 20:23567073-23567095 CAGGGGTCAGAGAACCAGCCAGG + Intronic
1171243252 20:23588043-23588065 CAGGGTCAAGAGAAGGACCAAGG - Intergenic
1171309345 20:24134147-24134169 GAGGGGTGACAGAAAGAGCATGG + Intergenic
1172231910 20:33342380-33342402 CAGGGATGAGTGAATGAGCATGG - Intergenic
1172631215 20:36379331-36379353 CAGGGGGAAGAGATGGAACCAGG + Intronic
1172665814 20:36598985-36599007 GAGAGGTAAGAGGAGGAACAGGG + Intronic
1172859160 20:38033802-38033824 CAGGGGTGCGAGAAGGGGGAGGG - Exonic
1172893842 20:38285683-38285705 CAGGAGGAAGAGAAAGAGCAGGG - Intronic
1173039413 20:39447126-39447148 CAGGGGTAAGACACGGAATATGG + Intergenic
1173048760 20:39538503-39538525 CAGGTGCAAGAGAAAGAGGAAGG - Intergenic
1173618234 20:44416627-44416649 CATGGGGAATAGAAGGGGCAAGG + Intronic
1173636927 20:44567734-44567756 CAGGATTAAGAACAGGAGCAGGG + Intronic
1173646489 20:44636300-44636322 CAGGGGGAAGAGAGAGAGAAAGG + Intronic
1173649288 20:44652673-44652695 CAGGTGAAAGGGAAGGAGCCGGG + Intergenic
1174082136 20:47978107-47978129 CAGGGCTAACAGATGAAGCATGG - Intergenic
1174095690 20:48087940-48087962 CAGGGCTGAGAGATGGAGGAGGG - Intergenic
1174134345 20:48368678-48368700 CAGGGCTAACAGATGAAGCATGG + Intergenic
1174173621 20:48631821-48631843 GAGGGGTGAGAGCAGGAGCCAGG - Intronic
1174216519 20:48920743-48920765 GAGGGGAAAGAGTAGGAGAAAGG - Intergenic
1174293580 20:49527233-49527255 CAGGAGTTAGAGAACCAGCATGG + Intronic
1175128995 20:56775112-56775134 CAGGAGAAAGAGAAGGGGGAGGG - Intergenic
1175401164 20:58700867-58700889 CAGGGGCAGGAGAAGGGGCAGGG + Intronic
1175419273 20:58821161-58821183 CAGGGGCCAGGGAAGGAGCTGGG - Intergenic
1175546216 20:59779608-59779630 CAGGGGAAAGAGAGGGAGAGAGG - Intronic
1175699305 20:61125468-61125490 CAGGGGGAGGGGAAGGAGAAGGG + Intergenic
1175780199 20:61677188-61677210 CTGGAGTAGGGGAAGGAGCAGGG + Intronic
1176115024 20:63428436-63428458 CTGGGGCAAGAGAAGGAGAGGGG + Intronic
1176261189 20:64181622-64181644 CAGCGGTTAGAGCAGGAACAAGG - Intronic
1176407545 21:6429656-6429678 CAGGGGTTACAGAAGAAGCGTGG + Intergenic
1176898828 21:14416308-14416330 CATGGGTAAGTGTAGCAGCATGG - Intergenic
1177333606 21:19694704-19694726 CAGGGGCAACAGAAGTAGCATGG + Intergenic
1177866505 21:26518948-26518970 CAGGCCTGAGTGAAGGAGCAAGG - Intronic
1177967009 21:27740259-27740281 CAGTGGTAAGAGGGGGAGAAGGG + Intergenic
1178285490 21:31322269-31322291 CAGGAGGAGAAGAAGGAGCAAGG - Intronic
1178422721 21:32455229-32455251 AAGGGGCAAGAGAAGGAGAGAGG + Intronic
1179215866 21:39366817-39366839 AAGGGGGAAGAGAAGGGGGAAGG - Intergenic
1179710086 21:43208219-43208241 CTGGGGTCAGAGAAGGGGCTGGG + Intergenic
1180228906 21:46414596-46414618 CAGGAGGAGGAGGAGGAGCAGGG - Intronic
1180228924 21:46414665-46414687 CAGGAGGAGGAGGAGGAGCAGGG - Intronic
1180248199 21:46562440-46562462 CAGAGGCAAGGGAAGGAGCTTGG + Intronic
1180543135 22:16471460-16471482 TAGGGGGAAGAGTAGGAGGAGGG + Intergenic
1180883867 22:19225781-19225803 CACGGGAAAAAGTAGGAGCAAGG + Intronic
1180938290 22:19640292-19640314 CAGGGGCAAGGGGAGGAGAATGG - Intergenic
1181034814 22:20164802-20164824 CAGGGGTGGGAGGAGGGGCAGGG + Intergenic
1181034821 22:20164820-20164842 CAGGGGCAGGAGAAGGGGCAGGG + Intergenic
1181103222 22:20555352-20555374 CAGGGCTAGGAGGAGGAGGAGGG - Intronic
1181392418 22:22593432-22593454 TAGGGGGAACAGATGGAGCAGGG + Intergenic
1181784993 22:25220638-25220660 CAGGGGTAAGAGAGGAAGCCTGG - Intronic
1182062354 22:27407302-27407324 CCGGGGTGAGACAAGGACCAAGG + Intergenic
1182332276 22:29559678-29559700 GTGGGGCAAGAGAAGGAGAAGGG - Intronic
1182754559 22:32668376-32668398 GAGGGGAAAGAGAAGGGGAAAGG - Intronic
1182886407 22:33777666-33777688 AAGGGGAAGGAGAAGGAGAAGGG + Intronic
1183018095 22:35006438-35006460 CAGGGCTAAAAGCAGGAGCCAGG + Intergenic
1183048552 22:35241597-35241619 CAGGGGTAGAGGAAGCAGCAGGG - Intergenic
1183315610 22:37135448-37135470 CAGGGGTGGGAGAAACAGCAAGG + Intronic
1183529834 22:38347392-38347414 CAGGGGCATGAGCAGGAGCCTGG + Intronic
1184131466 22:42519300-42519322 CAGGGGCAAGAGGAGAAGGAGGG + Intronic
1184141692 22:42581516-42581538 CAGGGGCAAGAGGAGAAGGAGGG + Intergenic
1184257335 22:43294737-43294759 CACGGGGCAGAGAAGGAGGAGGG - Intronic
1184319454 22:43729071-43729093 AAGTGGCAAGAGAGGGAGCAAGG + Intronic
1184333471 22:43840224-43840246 GAGGGGTAAGGCCAGGAGCAGGG + Intronic
1184892977 22:47390704-47390726 CGGGGCGCAGAGAAGGAGCAGGG - Intergenic
1185342756 22:50299076-50299098 CAGGGGCCAGAGGAGGTGCATGG + Intronic
949702589 3:6776301-6776323 CAGGGGGTAGAGGGGGAGCAGGG - Intronic
950589572 3:13926946-13926968 GATGTGGAAGAGAAGGAGCATGG - Intergenic
950921351 3:16697846-16697868 CAGGGGGAAGAAAAGGAGGCAGG + Intergenic
951795921 3:26538222-26538244 AAGGGGAAAGGGAAGGAGAAGGG + Intergenic
951843954 3:27065396-27065418 CATGGGAAAGAGAAATAGCATGG - Intergenic
952145647 3:30529060-30529082 GAGAGATAAGAGAAGAAGCAGGG - Intergenic
952400782 3:32961347-32961369 GGGTGGTAAGAGATGGAGCAGGG + Intergenic
952489265 3:33850893-33850915 AAGGGGGAAGGGAAGGAGAAAGG - Intronic
953215411 3:40913539-40913561 CAGGGGCAAGAGAATGGGCTGGG + Intergenic
953799252 3:46009286-46009308 TAGGGGCAAGGGAAGAAGCAGGG + Intergenic
953818989 3:46188101-46188123 CAGGAGTGAGAGGGGGAGCATGG - Intronic
955033862 3:55247612-55247634 CAAGGTAAAGAGAAGGAGAAAGG - Intergenic
955634620 3:61014002-61014024 GAGGGGCAAGAGACGGGGCAAGG + Intronic
955840773 3:63110445-63110467 GAGGAGGAAGAGAAGGAGGAGGG + Intergenic
955906695 3:63815017-63815039 CAGGGGCAAGAGAGAGAGCAGGG + Intergenic
956265514 3:67392157-67392179 CAGGGGTCAGTGAAGGAGGAAGG - Intronic
956652082 3:71513500-71513522 GTGGGGTAAGAGAAGGAGCAGGG - Intronic
956724425 3:72145492-72145514 CAGAAGGAAGAGAAGGAGGAAGG + Intergenic
957387675 3:79518418-79518440 AAGGGGAAAGAAAAGAAGCACGG - Intronic
958552684 3:95637202-95637224 CTGGGGTATGAAAGGGAGCAGGG - Intergenic
959129739 3:102339859-102339881 CAGTGGTCAAAGGAGGAGCAAGG - Intronic
959748424 3:109804429-109804451 CATGGGTAAGAGAAAAAGCTGGG + Intergenic
959856635 3:111166358-111166380 CAGGGATCAGAAAAGGAGCATGG - Intronic
960405786 3:117257755-117257777 AAGGGGGAAGAGGAGGAGAACGG + Intergenic
960611326 3:119557568-119557590 CAGGGTTAAGAGAAAGGACATGG - Intronic
961002161 3:123381260-123381282 CAGGGGTCAGGGCAGGAGCTTGG + Intronic
961334366 3:126161449-126161471 CAGGAGTCACAAAAGGAGCAAGG + Intronic
961454424 3:127017115-127017137 CAGGGGTAGGGGCAGGGGCAGGG - Intronic
962037431 3:131667581-131667603 GAGGGGGGAGAGAAGGATCAGGG - Intronic
962070464 3:132028510-132028532 AAGGGGTAAGAGATGGGGGAAGG + Intronic
962324532 3:134422462-134422484 CAGGAGCAAGAGAAGGAGAGGGG - Intergenic
962325976 3:134432537-134432559 CTCAGGTAAGAGAAGGGGCATGG + Intergenic
963258935 3:143175091-143175113 CAGGATTAAGAGAACGAGCAGGG + Intergenic
963561283 3:146869149-146869171 AAGGGGAGAGAGAGGGAGCAGGG - Intergenic
963602192 3:147388350-147388372 GAGGGGAAAGAAAAGGAGAAAGG - Exonic
963603616 3:147396732-147396754 AAGGGGTAATGGAAGGCGCAGGG + Intronic
964143654 3:153433005-153433027 TGGGGGTAAGAGGGGGAGCATGG - Intergenic
965654089 3:170965290-170965312 CAAGGGTAAGAGAAGCAGTATGG + Intergenic
965673788 3:171173910-171173932 CAGGGAGAAGAGAGGAAGCAGGG + Intronic
966681581 3:182647030-182647052 TAGGGATAAGAGCAGAAGCAGGG - Intergenic
967010740 3:185431028-185431050 CAGGAGACAGAGAAGGGGCAAGG + Intronic
967113529 3:186317035-186317057 CAAGGGTCAGAGAAGGACAAAGG + Intronic
967428168 3:189351280-189351302 CAGGGGTTAGAGATGGGGCTAGG + Intergenic
967658624 3:192078304-192078326 CATGGGTGAGAGCAGGAGCTGGG - Intergenic
968359976 3:198139860-198139882 GAGGGGTGGGAGAAGGAGAAGGG + Intergenic
969695187 4:8730251-8730273 CAGCAGCATGAGAAGGAGCAGGG + Intergenic
969924615 4:10574553-10574575 CAGGGGTAAGGGAAAGGGCGGGG - Intronic
969939903 4:10721732-10721754 CAGGAGAGGGAGAAGGAGCACGG + Intergenic
969979526 4:11140470-11140492 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
969984301 4:11191147-11191169 CAGGAGGAAGAGAGAGAGCAGGG + Intergenic
970213146 4:13731663-13731685 CAGAGATAAGAGAAGAGGCAGGG + Intergenic
970301079 4:14681854-14681876 CAGGAGAAAGAGAAAGAGAATGG + Intergenic
970352401 4:15216040-15216062 CAGGAGCAAGAGAGGGAGCAGGG - Intergenic
970536781 4:17038139-17038161 CTGAGGAAAGAGAATGAGCATGG - Intergenic
970709591 4:18846317-18846339 CAAGGGTAAGAGTAGGAAGATGG + Intergenic
971115212 4:23638285-23638307 CAGGGGAAAGAGTGGGAGTAAGG - Intergenic
971900580 4:32652902-32652924 TAGGGGGAAGAGTGGGAGCAGGG - Intergenic
972020936 4:34313196-34313218 CATGGCTAAGAGAGGGAGAAAGG + Intergenic
972169207 4:36324245-36324267 GAGGGGCCAGAGAAGGAGAAAGG - Intronic
972227579 4:37031439-37031461 CAGGGATAATAAAAGGAGAAAGG + Intergenic
972357073 4:38289785-38289807 CAGGGAGAAGAAAAGGAGCCTGG + Intergenic
972452246 4:39213557-39213579 CAGAGGTTAGAGATGGAGCTGGG + Intronic
973343700 4:49031648-49031670 CAGGGGCAAGAGTGGGAGCCAGG + Intronic
973587527 4:52408379-52408401 CAGGGGGAAGAGAGGGGACAAGG + Intergenic
973981932 4:56314703-56314725 CTGGGGGAAGAGGAGGAGGAGGG + Exonic
974451122 4:62061613-62061635 CAGGGGTGAAAGATGGAGGATGG - Intronic
976849969 4:89533677-89533699 CTGGGGTAAGGGTGGGAGCAAGG - Intergenic
976916354 4:90379928-90379950 CAGGGGCAAGAGGAAGAGAAGGG + Intronic
976974944 4:91154484-91154506 CAGGAGCAGGAGCAGGAGCAGGG - Intronic
977205461 4:94160601-94160623 GAGGGGTGAGAGAACAAGCATGG + Intergenic
977459610 4:97308951-97308973 CAGGGGAGAGAGAAGGGGAAGGG - Intronic
977948643 4:102943738-102943760 TAGGGGGAAGAGTAGGAGGAGGG + Intronic
979150275 4:117304485-117304507 CAGGTGAAAGAGAAGGTGAAAGG + Intergenic
980092331 4:128455623-128455645 GAGGGGGAAGGGAAGGAGGAAGG + Intergenic
980726764 4:136771814-136771836 GAGGGATAAGAGAATGAGTAGGG - Intergenic
981559633 4:146033055-146033077 CAGGGGTAGAAGAAGCAGCAAGG + Intergenic
981735206 4:147942581-147942603 AAGGGGCAGGAGAAGGAGGACGG - Intronic
981780219 4:148420822-148420844 CAGGAGCAAGAGAAGGAGTGGGG - Intronic
982256652 4:153457703-153457725 AAGGGGCAAGAGTAGAAGCAAGG + Intergenic
982744108 4:159088438-159088460 CTGGGGGAAGGAAAGGAGCAGGG + Intergenic
983521751 4:168716425-168716447 AAGTAGTAAGAGTAGGAGCAAGG - Intronic
984703495 4:182833193-182833215 GAGGGGAGAGAGAAGGAGGAGGG - Intergenic
985329993 4:188821521-188821543 CAGAGGGAAGAGCAAGAGCACGG + Intergenic
985385579 4:189444174-189444196 AAGGAGAAAGAGAAGGAGAAAGG - Intergenic
985790890 5:1926387-1926409 CAGGGGAAGGGGAAGGCGCAGGG - Intergenic
985984594 5:3504180-3504202 CTGGGGTCAGAGAAGAAGAAGGG - Intergenic
986360854 5:6976417-6976439 CAGGAGGAAGAGAGAGAGCAGGG - Intergenic
986457769 5:7937348-7937370 CAGGAGTAAGAGAGAGAGCAGGG - Intergenic
986858820 5:11903744-11903766 CAGCGGCAAGAGGAGGAGGACGG + Intronic
986970970 5:13336043-13336065 CAGGAGTAACACAAGGAGCAAGG + Intergenic
987032882 5:13991587-13991609 GAGGGGGAAGAGGAGGAGGAAGG + Intergenic
987071739 5:14343411-14343433 CAGGGGTTAGAGATGGAGCAGGG - Intronic
987239634 5:15981903-15981925 AAGGGGGAAGAGAGGGAGAAAGG + Intergenic
988496664 5:31751308-31751330 TGGGGGTTAGAGCAGGAGCAAGG + Intronic
988723655 5:33903830-33903852 CAGGGGTAGAGGAAGCAGCAGGG - Intergenic
988873539 5:35417977-35417999 CAGAGGGAAGAGGAGGAGAATGG - Intergenic
989087877 5:37695157-37695179 CAGGAGTAAGAGAAGGGGGAGGG + Intronic
989092754 5:37751061-37751083 CAGGGGGAAAAAAAGGAACAAGG - Intronic
989098894 5:37806553-37806575 CAGGGGCAAAAGCAGAAGCATGG - Intergenic
990742532 5:58926708-58926730 CAGGGGAAAGAGGAAGGGCAGGG + Intergenic
990902400 5:60766859-60766881 CTGGGGTTAGAGAGGGAGAATGG - Intronic
991659501 5:68935843-68935865 CAGGAGTAAGAGAAAGAAGAGGG - Intergenic
994167818 5:96626294-96626316 CGGGAGTAAGAGAGGCAGCAGGG - Intronic
994520968 5:100834745-100834767 CAGGGTCAAGAGAAAGAGCTGGG - Intronic
994569989 5:101503857-101503879 CAGGAGCAAGAGAAAGAGGAAGG - Intergenic
995609196 5:113890928-113890950 CAGGGTGTAGAGAAGGATCAAGG - Intergenic
996012119 5:118492811-118492833 AAAGGGTAAGAGAAGGTGAAGGG + Intergenic
996339367 5:122419041-122419063 CAGGGGTCAAGGAAGGAGAAGGG + Intronic
996440600 5:123486011-123486033 CAGATGTAAGAGGAGGAGGAGGG - Intergenic
996801271 5:127406284-127406306 CAGGGGCCAGAGAAAGAGAAGGG + Intronic
996849679 5:127938084-127938106 CAGGAGTAGGAGAAGGAAAATGG - Intergenic
996926862 5:128837700-128837722 AAGGGATTAGAGAAGGAGGAAGG + Intronic
997510168 5:134448527-134448549 CAGAGGTAAGAGAGAGACCAAGG - Intergenic
997523546 5:134538426-134538448 CAGTGGAATGAGAAGCAGCAGGG + Intronic
997871644 5:137510899-137510921 GAGGGGTATGAGGATGAGCAGGG + Intronic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
998760731 5:145429138-145429160 CAGAGGTCAGAGCAGAAGCAAGG + Intergenic
998823478 5:146077919-146077941 CAGGGTTTAGAGTAGGAGTAGGG + Intronic
998878003 5:146619752-146619774 GAGAGGTTAGGGAAGGAGCATGG - Intronic
998978140 5:147671049-147671071 AAGAGGTGAGTGAAGGAGCATGG + Intronic
999019220 5:148144635-148144657 AAAGGGGAAGAGAAGGAGCAGGG - Intergenic
999082202 5:148855231-148855253 CCAGGGGAAGAAAAGGAGCATGG + Intergenic
999268324 5:150281399-150281421 CTGGGGGAAGAGAAAGAGCTGGG + Intronic
999379259 5:151108831-151108853 CTGGGGTAGTAAAAGGAGCACGG + Intronic
1000239119 5:159392872-159392894 CAGGAGGAAGAGAGAGAGCAGGG - Intergenic
1000240839 5:159406678-159406700 CTGGGGATAGAGTAGGAGCACGG - Intergenic
1000761534 5:165231279-165231301 CAGGAATAAGAGAGGGGGCATGG + Intergenic
1001265254 5:170269408-170269430 CAGGGAAAAGGGTAGGAGCAAGG + Intronic
1001266432 5:170277840-170277862 AAGAGGAAAGAGAAGGAGGAAGG + Intronic
1001456191 5:171862121-171862143 CAGGGGGAAGGGAGGGGGCAGGG - Exonic
1001642358 5:173253363-173253385 CAGGTGTTAGGGAAGGAGAATGG + Intergenic
1001924660 5:175627386-175627408 CAGGGCTATGGGAAGGAGCAAGG + Intergenic
1002107269 5:176886260-176886282 GAGAGGTCAGAGCAGGAGCAGGG + Intronic
1003262446 6:4531850-4531872 AAGGCATAAGAGAAGGGGCATGG + Intergenic
1003516050 6:6819550-6819572 CAGGGGTTAGATATGGAGGAGGG + Intergenic
1003787776 6:9506327-9506349 CAAAGGTGAGAGAAGGAGCCTGG - Intergenic
1003977835 6:11360584-11360606 CAGGAGGAAGAGAGAGAGCAGGG - Intronic
1004428639 6:15523788-15523810 CCTGGGGAAGAGAAGGAGCTTGG - Intronic
1004962762 6:20810241-20810263 CTGGGGCAAGAGAAGGGGCAAGG - Intronic
1005167729 6:22944301-22944323 CAGGAGAAAGAGAAGGAGGTGGG + Intergenic
1005276411 6:24223975-24223997 CAGTGTTAAGAGAAAGACCAAGG - Intronic
1005784347 6:29227675-29227697 CATGGGTAAGAGAGGGTGAAAGG - Intergenic
1005792700 6:29322408-29322430 CAGGGGAAAGGGTGGGAGCAGGG - Intergenic
1006180749 6:32152077-32152099 CCGGGGTAAGAGGAGGAGAGAGG - Intronic
1007233926 6:40377093-40377115 CAGGAGAAAGAGAGGGAGGAGGG + Intergenic
1007501701 6:42303440-42303462 CAGGGGAAAGATAGAGAGCAAGG + Intronic
1007714791 6:43849482-43849504 CAGGGAGAGGAGAAGAAGCAGGG + Intergenic
1008035254 6:46738434-46738456 AAGGGGTAGGAGCAGGAGTAAGG + Intergenic
1008522318 6:52374034-52374056 CAGGAGTAAGAGAGGGAGTGGGG - Intronic
1008815494 6:55559558-55559580 CAGGGGCACAAGAAGGAGCGTGG + Intronic
1009033372 6:58087159-58087181 CAGGAGCAAGAGAGAGAGCAGGG + Intergenic
1009208985 6:60838928-60838950 CAGGAGCAAGAGAGAGAGCAGGG + Intergenic
1009825967 6:68866317-68866339 CAGGAGAAAGAAAGGGAGCAAGG - Intronic
1010244534 6:73651053-73651075 CAGGGAAAAGAAAAGGAGCGGGG + Intronic
1011198666 6:84809773-84809795 CAGGGATAAGAGACACAGCAGGG + Intergenic
1011216239 6:85008862-85008884 CAGGAGAAAGAGAGAGAGCATGG - Intergenic
1011967722 6:93180214-93180236 CAGCTGAAAGAGAAGGAGAAAGG - Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012815630 6:104018769-104018791 CAGCAGTCAGAGAAGCAGCATGG - Intergenic
1013768887 6:113605049-113605071 GAGGGGCAAGAGAAGGAGGAAGG - Intergenic
1013926037 6:115473689-115473711 CAGGGGTGGGAGGAGGAGGAAGG + Intergenic
1014092763 6:117423155-117423177 TAGGGGAAAGAGTGGGAGCAGGG + Intronic
1014104835 6:117549883-117549905 CAGTGGAAAGAGAAAGAGCTTGG + Intronic
1014561973 6:122901675-122901697 CAGCACTAAGAGATGGAGCAAGG - Intergenic
1014783334 6:125589488-125589510 CATGGCTAACAGAAGGAGCTGGG - Intergenic
1015374803 6:132498066-132498088 CATGGGTAAAAGATGGAGCATGG + Intronic
1015619341 6:135114009-135114031 CAGGCGTAAGTGACAGAGCAAGG - Intergenic
1016154269 6:140784175-140784197 CAGGGGGTGGAGAAGGAGCATGG + Intergenic
1016161323 6:140884000-140884022 AAGGGGAAGGAGAAGGAGAACGG - Intergenic
1016268680 6:142261956-142261978 CAGGAGTGAGAGAGGGAGCAAGG - Intergenic
1016463383 6:144301924-144301946 CAGAGGTAAGAAAAGGACCATGG - Intronic
1016505994 6:144779615-144779637 CAGGGGTAACAGAGGCAGAAAGG + Intronic
1016581242 6:145631062-145631084 CCAGGGTAAGAGCAGCAGCATGG - Intronic
1016674872 6:146752242-146752264 CAGGAGTAAGAGAGAGAGAAAGG + Intronic
1016920518 6:149288796-149288818 GAGGGGCAAGAGCAGAAGCAGGG - Intronic
1017073190 6:150594673-150594695 AAGGGGGAAGAGAAAGAGCAGGG + Intergenic
1017552147 6:155520477-155520499 CAAGAGTTAGAGAAGCAGCAGGG - Intergenic
1018123995 6:160664478-160664500 TAGGGGTGAGGGAAGGAGTAAGG - Intergenic
1018160894 6:161041374-161041396 CAGGGTTAGGGGAAGGACCAGGG - Intronic
1018276664 6:162139511-162139533 CAGGGTAAAGAGAATCAGCATGG + Intronic
1019004630 6:168785975-168785997 AAGGGGGAAGGGAAGGAACATGG + Intergenic
1019260013 7:76760-76782 GAGGGGTGGGAGAAGGAGAAGGG - Intergenic
1019334844 7:478278-478300 CAGGGCTATGGGAAGGACCAGGG + Intergenic
1019346845 7:535288-535310 CAGGGTGAAGAGGAGGAGCCGGG - Intergenic
1019401620 7:857266-857288 CAGGTGTGAGAGCTGGAGCACGG + Intronic
1020141333 7:5613564-5613586 CTGTGGTAAGAAAATGAGCAGGG - Intergenic
1021559469 7:21955510-21955532 CAGGGGTTAAGGAAGGAGGAAGG - Intergenic
1021600974 7:22362829-22362851 CAGGGGATAGAGGAGTAGCAGGG + Intergenic
1021795020 7:24245779-24245801 GAGGGGCAAGAGGAGAAGCAGGG + Intergenic
1022095337 7:27137246-27137268 CAGGGGAAAGAGCAGGAGAAAGG + Intronic
1022480451 7:30740034-30740056 CCAGGGTAAGAGAAGGAGTGGGG + Intronic
1022493187 7:30836435-30836457 CAGGGTTGTGACAAGGAGCATGG + Intronic
1023310071 7:38877333-38877355 GAGGGGTAAAAGGGGGAGCAGGG + Intronic
1025818604 7:64942979-64943001 CAGGGGAATGAGGAGGAGCGGGG + Intergenic
1026018670 7:66692316-66692338 CATGGGTAAGAGAGGGAGGCAGG - Intronic
1026028118 7:66763634-66763656 GAGGGATAAGAGAAAGGGCATGG - Intronic
1026354049 7:69541937-69541959 TAGGAGGAAGAGAGGGAGCAGGG + Intergenic
1026800599 7:73397737-73397759 AAGGGGGAAGAAAAGGAGAAGGG + Intergenic
1026800605 7:73397755-73397777 AAGGGGGAGGAGAAGGAGAAGGG + Intergenic
1026800611 7:73397773-73397795 AAGGGGGAGGAGAAGGAGAAGGG + Intergenic
1026881732 7:73910382-73910404 CATGGGTAAGAGAGGGAGGCAGG + Intergenic
1026905054 7:74058007-74058029 AAGGAGAAAGAGAAGGAGAAGGG - Intronic
1027581746 7:80005425-80005447 CAGGAGGAAGAGAGAGAGCAGGG - Intergenic
1028203666 7:87992226-87992248 CAGAGGAAAGAGATGGAACAAGG + Intronic
1028488572 7:91386369-91386391 CATGCCTCAGAGAAGGAGCAGGG + Intergenic
1028570045 7:92277038-92277060 CAGGAGCAAGAGAAAGAGCAAGG - Intronic
1028638928 7:93021763-93021785 CAGGAAAAAGAGAAGGAGAAAGG + Intergenic
1029137825 7:98387148-98387170 CAGAGGGTAGGGAAGGAGCAAGG + Intronic
1029306934 7:99626452-99626474 CTGGGGTAAGAGCAGGAACCAGG + Intronic
1029308780 7:99641862-99641884 CAGAGGAAAGAGTAGAAGCAGGG - Intergenic
1029403395 7:100358779-100358801 CAGGGGTAATAGAAGGAGAAGGG - Exonic
1029405973 7:100374133-100374155 CAGGGGTAATAGAAGGAGAAGGG - Exonic
1029478356 7:100798618-100798640 TAGGGGAGACAGAAGGAGCAGGG + Intergenic
1029501954 7:100936830-100936852 GAGGTAGAAGAGAAGGAGCAGGG - Intergenic
1030002726 7:105082619-105082641 CAGGGGTGACAGAGGGAGAAGGG + Intronic
1030128520 7:106177821-106177843 CAAGGGAAAGAGACAGAGCAGGG - Intergenic
1031412867 7:121460972-121460994 CAGAAGAAAAAGAAGGAGCAGGG - Intergenic
1031534566 7:122917235-122917257 CAGGGTTAAGATAAGGGGTATGG - Intergenic
1031997944 7:128245233-128245255 CAGGGGAAAGAGGGGAAGCAGGG - Intronic
1032019640 7:128400216-128400238 CAGGTGAGAGAGAAGGAGCCAGG + Intronic
1032509378 7:132459924-132459946 CATGGGGAAGAGAAGGGGCGGGG - Intronic
1032854744 7:135825034-135825056 CAGAGCTCAGAGAAGCAGCAGGG + Intergenic
1033454330 7:141488947-141488969 GAGGAGAAAGAGAAGGAGGAGGG + Intergenic
1033890439 7:146006416-146006438 CAGGGGGAGGAGAAGGAGCAGGG - Intergenic
1034014369 7:147566305-147566327 GAGGAGTAAGAGGAGGAGGAGGG + Intronic
1034702873 7:153111437-153111459 CAGGGGACAGAGGAGGCGCAGGG + Intergenic
1034929196 7:155147905-155147927 CAGGGGGAAGAGAGAGAGGAGGG - Intergenic
1035161151 7:156950608-156950630 CAGGGGGAAGAAAAGGAAAAGGG + Exonic
1035237678 7:157509233-157509255 GAGGGGGGAGAGAAGGAGAAGGG + Intergenic
1035240124 7:157523890-157523912 CAGGGGTCAGAGAGTGAGCCTGG + Intergenic
1035289005 7:157825241-157825263 AAGGGGGAAGAAGAGGAGCAGGG - Intronic
1036163081 8:6406866-6406888 CGGGGGAGAGAGCAGGAGCAGGG - Intronic
1036218842 8:6903629-6903651 CAGGGGGAAGAGAAAGGACAGGG + Intergenic
1036621103 8:10424905-10424927 CGGGGGACAGCGAAGGAGCAGGG + Intronic
1036634362 8:10538738-10538760 CAGGGGACAGAGCAGGAGCCAGG - Exonic
1037546572 8:19929668-19929690 AAGGGGAAAGGGAAAGAGCATGG - Intronic
1037682213 8:21106859-21106881 CAGAGGGCTGAGAAGGAGCAGGG + Intergenic
1037728104 8:21500786-21500808 GTGGGGTAAGAGAAGCTGCATGG - Intergenic
1038063549 8:23938209-23938231 CTGGGGTTGGAAAAGGAGCAAGG + Intergenic
1038320940 8:26526830-26526852 CAAGGGTATGAGAAGGATCTGGG + Intronic
1038415950 8:27396139-27396161 CAAGGATGAGAGAAGGAGCTGGG - Intronic
1038426926 8:27469677-27469699 CTGGGGTAGAGGAAGGAGCAGGG + Intronic
1038450860 8:27637907-27637929 CAGGGGCACGGGAAGGAGCCAGG + Intronic
1038483747 8:27919182-27919204 GAGGGGAAAGAGGAGGAGGAGGG + Intronic
1038497353 8:28013111-28013133 GAGAGGGAAGAGAGGGAGCATGG + Intergenic
1038497384 8:28013249-28013271 GAGGAGGAAGAGAGGGAGCAAGG + Intergenic
1038662560 8:29509816-29509838 CAGGAGGAAGAGAGGGAGCAGGG + Intergenic
1038743406 8:30235232-30235254 AAGGAGTAAGACAAAGAGCATGG - Intergenic
1039447785 8:37646474-37646496 CAGGGGCAAGAGAGAGAGGAGGG + Intergenic
1039492633 8:37959370-37959392 CCGGGATAAGAGAAGAGGCAAGG + Intergenic
1039882370 8:41632933-41632955 CAGGGGTAGGGGTAGGGGCAGGG - Intergenic
1039899276 8:41739880-41739902 CTGGGAGAAGAGTAGGAGCATGG - Intronic
1039988597 8:42468601-42468623 CAGAGGAAAGAGATGAAGCATGG + Intronic
1041401366 8:57448750-57448772 GAGGGGGAGGAGAAGGAGGAGGG - Intergenic
1041426029 8:57721634-57721656 CAGGAGTAAGAGATGGAGAAGGG + Intergenic
1041746155 8:61211340-61211362 GAGGGGGAAGAGAAGAAGGAGGG - Intronic
1043185050 8:77138000-77138022 AAGGGGGAAGAGAAAGAGAAAGG - Intergenic
1044402224 8:91786119-91786141 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
1044402229 8:91786137-91786159 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
1044696456 8:94927283-94927305 GAGGAGGAAGAGAAGTAGCAAGG + Exonic
1044983270 8:97736430-97736452 GAGGGGGAGGAGAAGGAGAAAGG + Intergenic
1045193726 8:99908760-99908782 CAGAGAGAAGAGAAGGAGGAGGG + Intergenic
1045423874 8:102043692-102043714 GAGGAGGAAGAGAAGGGGCAGGG + Intronic
1045474635 8:102542557-102542579 GAGGGGGAAGAGAAGGGGGAAGG - Intergenic
1045522391 8:102914600-102914622 CCTGGGGAAGAGAAGGAGCATGG - Intronic
1046074319 8:109299068-109299090 CAGGGGTAGAGGAAGCAGCAGGG + Intronic
1046446626 8:114329441-114329463 CAGGGGGAAGAGAGAGAGCGGGG + Intergenic
1046742388 8:117843470-117843492 CAGGGGTAAGAGGAGGTGATGGG + Intronic
1048005068 8:130412395-130412417 CAGGAGCAAGAGAGAGAGCAAGG - Intronic
1048043007 8:130748960-130748982 CTGGGGCAAGAGAGGGAGAAGGG + Intergenic
1048369880 8:133768028-133768050 CAGGAGGAAGAGATGGAGGAAGG - Intergenic
1048517707 8:135125563-135125585 CAGAGGTCAGATAAGGAGCCTGG - Intergenic
1048518916 8:135136116-135136138 GAGGGGAAGGAGAAGGAGAAGGG + Intergenic
1048618856 8:136109389-136109411 AAGGAGTAAGAGAGAGAGCAGGG - Intergenic
1048773287 8:137918841-137918863 CAGGAGAGAGAGAAGGAGAAGGG - Intergenic
1048988376 8:139747614-139747636 CAGGGATCAGAGAAGATGCAGGG + Intronic
1048988409 8:139747733-139747755 CAGGGATCAGAGAAGATGCAGGG + Intronic
1048988441 8:139747851-139747873 CAGGGATCAGAGAAGATGCAGGG + Intronic
1048988470 8:139747969-139747991 CAGGGATCAGAGAAGATGCAGGG + Intronic
1048988502 8:139748088-139748110 CAGGGATCAGAGAAGATGCAGGG + Intronic
1048988534 8:139748206-139748228 CAGGGATCAGAGAAGATGCAGGG + Intronic
1048988563 8:139748324-139748346 CAGGGATCAGAGAAGATGCAGGG + Intronic
1048988592 8:139748443-139748465 CAGGGATCAGAGAAGATGCAGGG + Intronic
1049580656 8:143409091-143409113 CAGGGGTGGGAGGAGGGGCAGGG + Intergenic
1050952112 9:11610750-11610772 GAGGGGAAAGAGAAGGAGAGAGG - Intergenic
1051193985 9:14543237-14543259 CAGCTGTGTGAGAAGGAGCATGG - Intergenic
1051335524 9:16062698-16062720 CATGAGTAAGATAAGGAGCCTGG + Intergenic
1052502984 9:29316826-29316848 CAGGGACAAGAGATGGAGCAGGG + Intergenic
1052523791 9:29585977-29585999 CAGTGGTTAGAGGAAGAGCAGGG + Intergenic
1053215769 9:36269251-36269273 AAGGGGCAAGAGGAGGAGTAGGG - Intronic
1053365086 9:37517206-37517228 CAGGGGGAAGGGTGGGAGCAGGG + Intronic
1053441621 9:38120958-38120980 GAGGGGGAGGAGAAGGAGGAGGG + Intergenic
1054736168 9:68752538-68752560 AAGAAGGAAGAGAAGGAGCAAGG - Intronic
1055151893 9:73010401-73010423 CAGAAATAAGAGAAGGAACATGG - Intronic
1055828924 9:80358254-80358276 CAGGGGTGGGAGGAGGAGCTGGG + Intergenic
1056300191 9:85232300-85232322 CCGGGTTAAGGGAAGGTGCACGG - Intergenic
1056546836 9:87620542-87620564 AAGGAGGAAGAGAAGGAGTAGGG + Intronic
1056575955 9:87856321-87856343 CAGAGGTAGGAGGAGGAGCTGGG + Intergenic
1056947346 9:91009980-91010002 CAGGAGCAAGAGAGAGAGCAGGG - Intergenic
1057076142 9:92139113-92139135 AAGGAGACAGAGAAGGAGCAGGG - Intergenic
1057752355 9:97803239-97803261 CAGGCGGAAGAGAAGGAGGGAGG + Intergenic
1057882363 9:98802153-98802175 CAGGGTGAAGAGAAACAGCAGGG + Intergenic
1058069093 9:100583521-100583543 TAGGGGCAAGAAAAGAAGCAGGG - Intronic
1058482515 9:105411344-105411366 CAGGGGAAGGGGAAGGAGAAGGG - Intronic
1058642307 9:107099541-107099563 GGGGGGTAAGAGTAGAAGCAGGG - Intergenic
1059084472 9:111285209-111285231 GGGGGTTAAGAGAGGGAGCAGGG - Intergenic
1059169825 9:112114656-112114678 CAGGGATGGGACAAGGAGCAGGG - Intronic
1059452449 9:114378946-114378968 CAAGGGTAGGGGAAAGAGCATGG - Intronic
1060500684 9:124151659-124151681 GAGGAGTAAGAAAAGGAGAAAGG - Intergenic
1060558377 9:124521968-124521990 CAGGGGTAAGGGGGGCAGCAAGG + Exonic
1061204814 9:129156750-129156772 CAGGAGGAAGAGGAGGAGGAGGG - Intergenic
1061366903 9:130176947-130176969 CATGGGGAGGAGAAGGAGAAGGG - Intronic
1062057207 9:134474899-134474921 CAGGGGCTAGGGATGGAGCAGGG - Intergenic
1062074738 9:134579769-134579791 AAGGGGGAAGAGGAGGAGGAGGG + Intergenic
1062074755 9:134579811-134579833 AAGGGGGAAGAGGAGGAGGAGGG + Intergenic
1062074773 9:134579854-134579876 AAGGGGGAAGAGGAGGAGGAGGG + Intergenic
1062205730 9:135335849-135335871 CAGGGGCCAGAGCAGGTGCAGGG + Intergenic
1062320150 9:135986747-135986769 CAGGGGTCAGAGATGCAGCCGGG - Intergenic
1062551498 9:137089540-137089562 CAGGGCTGGGAGAGGGAGCAGGG + Intronic
1062592875 9:137281832-137281854 CAGGGCTAGGGGAAGGAGCTGGG + Exonic
1062744684 9:138203704-138203726 GAGGGGTGGGAGAAGGAGAAGGG + Intergenic
1185462412 X:339450-339472 CAGGGGTGAGGGGAGGAGCCGGG + Intronic
1185826365 X:3255100-3255122 CAGGAGCAAGAGAGAGAGCAGGG + Intergenic
1185836158 X:3347021-3347043 CAGGAGAGAGAGAAGGAGCAGGG + Intergenic
1186156645 X:6733043-6733065 CAGGGTGATGAGAAGGGGCATGG + Intergenic
1186614129 X:11169047-11169069 CAGGGGACAGAGAAGTGGCATGG + Intronic
1186810937 X:13187900-13187922 CTGGGGGAAGAGAAGAAACAGGG - Intergenic
1187576224 X:20559173-20559195 CAAGGGAAGGAGAAGGAGAAGGG - Intergenic
1187696680 X:21929520-21929542 CAGGGGAAGGAGTAGGAGCCAGG + Intergenic
1187843796 X:23515450-23515472 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
1188074571 X:25759375-25759397 AAGGGTTCAGAGAAGGAGCGAGG + Intergenic
1188218387 X:27508249-27508271 AAGGGATGGGAGAAGGAGCAGGG + Intergenic
1188328512 X:28837856-28837878 AAGGGGTAAGAGATGGGGCTTGG - Intronic
1188329415 X:28850526-28850548 TAGGGGGAAGAGAGGGAGGAAGG - Intronic
1188740250 X:33769281-33769303 CAAGGGGGAGAGAAGAAGCAGGG + Intergenic
1190137339 X:47808749-47808771 CATGGGTAAGAGCAGTGGCATGG + Intergenic
1190993708 X:55582917-55582939 GAAGGGTAAGAGAAAGAGAAAGG + Intergenic
1191099598 X:56711461-56711483 CAGGTGAAAGAGTGGGAGCAGGG + Intergenic
1191599891 X:62991258-62991280 AAGGGGGAAGAGAAGGATCTAGG - Intergenic
1191842875 X:65525469-65525491 CAGGGAGAAGAGAAGGGGTAGGG - Intronic
1192205370 X:69092396-69092418 GAGGGGCAAGAGTAGAAGCAGGG + Intergenic
1192244380 X:69360590-69360612 GAGGGGCAAGAGAAGAAGCAGGG + Intergenic
1192527956 X:71863762-71863784 CAGGAGCAAGAGAGAGAGCAGGG + Intergenic
1193102136 X:77626279-77626301 TTGGGGTAAGAGTAGGAGGAGGG + Intronic
1193945100 X:87724684-87724706 CAGGGGTAAGTGAAGGAGAGAGG + Intergenic
1194388434 X:93286791-93286813 CAGGAGGAAGACAATGAGCAGGG + Intergenic
1194431396 X:93811289-93811311 AAGGGGAAATAGAAGGAGAAAGG - Intergenic
1194728666 X:97428656-97428678 GAGGGTTAAGAGAAGAAGGAGGG - Intronic
1196193304 X:112815801-112815823 CAGAGGTCAGAGAAGAAGTAGGG + Exonic
1196199352 X:112867965-112867987 CAGTGTTAAGAGATGGAGCTAGG + Intergenic
1196434746 X:115664792-115664814 CAGTGGCAGGAGATGGAGCAGGG - Intergenic
1197545774 X:127822189-127822211 CAGGGGAAAGGGAGGGAGTAGGG + Intergenic
1197650683 X:129060285-129060307 ACGTGGTAAGAGAGGGAGCAAGG - Intergenic
1197790770 X:130251816-130251838 CAGAGGTGACAGAAGGAGCCAGG + Intronic
1198393675 X:136201830-136201852 AAGTGGTAAGGGAAGAAGCATGG + Intronic
1198466740 X:136910210-136910232 GAGGGGAAAGAGAAGGAGATGGG - Intergenic
1198653935 X:138893128-138893150 CAGGGATATGAGAAGGACCTCGG + Intronic
1198979106 X:142374572-142374594 CAGGAGCAAGAGAGGGAGCGGGG - Intergenic
1199263974 X:145808734-145808756 CAGGAGGAGGAGAAGGAGAAGGG + Intergenic
1199950075 X:152699860-152699882 CTGAGGTAACAGCAGGAGCAGGG - Intronic
1199959599 X:152768601-152768623 CTGAGGTAACAGCAGGAGCAGGG + Intronic
1200114971 X:153765970-153765992 GAGGGGTCAGGGAAGGGGCAGGG - Intronic
1200379716 X:155822221-155822243 AAGGGGAAGGAGAAGGAGAAGGG + Intergenic
1200379724 X:155822245-155822267 AAGGGGAAGGAGAAGGAGAAGGG + Intergenic
1200834295 Y:7717961-7717983 CAGGGGAAAGAGAAGAAGTCTGG - Intergenic
1201184011 Y:11380298-11380320 TAGGGGGAAGAGTAGGAGGAGGG + Intergenic
1201334887 Y:12869957-12869979 CAGGAGGGAGAGAAGGAGGAAGG - Intergenic
1201474385 Y:14364718-14364740 AAGGAGGAAGAGAAGGAGCATGG + Intergenic
1201590653 Y:15611134-15611156 AAGGGGTGAGAGAAGGCACATGG + Intergenic