ID: 1167792212

View in Genome Browser
Species Human (GRCh38)
Location 19:51689589-51689611
Sequence CTGCGGAAAGGGAGGGTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167792200_1167792212 9 Left 1167792200 19:51689557-51689579 CCTGCGACGCGGGAGCCGCGGGA No data
Right 1167792212 19:51689589-51689611 CTGCGGAAAGGGAGGGTGGGGGG No data
1167792195_1167792212 15 Left 1167792195 19:51689551-51689573 CCCTTCCCTGCGACGCGGGAGCC No data
Right 1167792212 19:51689589-51689611 CTGCGGAAAGGGAGGGTGGGGGG No data
1167792194_1167792212 16 Left 1167792194 19:51689550-51689572 CCCCTTCCCTGCGACGCGGGAGC No data
Right 1167792212 19:51689589-51689611 CTGCGGAAAGGGAGGGTGGGGGG No data
1167792196_1167792212 14 Left 1167792196 19:51689552-51689574 CCTTCCCTGCGACGCGGGAGCCG No data
Right 1167792212 19:51689589-51689611 CTGCGGAAAGGGAGGGTGGGGGG No data
1167792198_1167792212 10 Left 1167792198 19:51689556-51689578 CCCTGCGACGCGGGAGCCGCGGG No data
Right 1167792212 19:51689589-51689611 CTGCGGAAAGGGAGGGTGGGGGG No data
1167792201_1167792212 -6 Left 1167792201 19:51689572-51689594 CCGCGGGAGCCGTGAGTCTGCGG No data
Right 1167792212 19:51689589-51689611 CTGCGGAAAGGGAGGGTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167792212 Original CRISPR CTGCGGAAAGGGAGGGTGGG GGG Intergenic
No off target data available for this crispr