ID: 1167792358

View in Genome Browser
Species Human (GRCh38)
Location 19:51690047-51690069
Sequence CTGGGCTGCCAGACAGGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167792353_1167792358 -1 Left 1167792353 19:51690025-51690047 CCGAGGAGGAGGGGGAGGTTGTC No data
Right 1167792358 19:51690047-51690069 CTGGGCTGCCAGACAGGCCAGGG No data
1167792346_1167792358 13 Left 1167792346 19:51690011-51690033 CCAGTGGGAGGGGGCCGAGGAGG No data
Right 1167792358 19:51690047-51690069 CTGGGCTGCCAGACAGGCCAGGG No data
1167792344_1167792358 18 Left 1167792344 19:51690006-51690028 CCGTGCCAGTGGGAGGGGGCCGA No data
Right 1167792358 19:51690047-51690069 CTGGGCTGCCAGACAGGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167792358 Original CRISPR CTGGGCTGCCAGACAGGCCA GGG Intergenic
No off target data available for this crispr