ID: 1167793290

View in Genome Browser
Species Human (GRCh38)
Location 19:51693504-51693526
Sequence CGTGTGGGTCTCAAGGCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167793290_1167793302 23 Left 1167793290 19:51693504-51693526 CCCCTGGCCTTGAGACCCACACG No data
Right 1167793302 19:51693550-51693572 TGCCGTCCCGTCTGCCCTGCTGG No data
1167793290_1167793305 29 Left 1167793290 19:51693504-51693526 CCCCTGGCCTTGAGACCCACACG No data
Right 1167793305 19:51693556-51693578 CCCGTCTGCCCTGCTGGCCCTGG No data
1167793290_1167793298 -4 Left 1167793290 19:51693504-51693526 CCCCTGGCCTTGAGACCCACACG No data
Right 1167793298 19:51693523-51693545 CACGATGGCCCTGCTGGCTCTGG No data
1167793290_1167793295 -10 Left 1167793290 19:51693504-51693526 CCCCTGGCCTTGAGACCCACACG No data
Right 1167793295 19:51693517-51693539 GACCCACACGATGGCCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167793290 Original CRISPR CGTGTGGGTCTCAAGGCCAG GGG (reversed) Intergenic
No off target data available for this crispr