ID: 1167793292

View in Genome Browser
Species Human (GRCh38)
Location 19:51693506-51693528
Sequence ATCGTGTGGGTCTCAAGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167793292_1167793302 21 Left 1167793292 19:51693506-51693528 CCTGGCCTTGAGACCCACACGAT No data
Right 1167793302 19:51693550-51693572 TGCCGTCCCGTCTGCCCTGCTGG No data
1167793292_1167793298 -6 Left 1167793292 19:51693506-51693528 CCTGGCCTTGAGACCCACACGAT No data
Right 1167793298 19:51693523-51693545 CACGATGGCCCTGCTGGCTCTGG No data
1167793292_1167793305 27 Left 1167793292 19:51693506-51693528 CCTGGCCTTGAGACCCACACGAT No data
Right 1167793305 19:51693556-51693578 CCCGTCTGCCCTGCTGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167793292 Original CRISPR ATCGTGTGGGTCTCAAGGCC AGG (reversed) Intergenic
No off target data available for this crispr