ID: 1167793298

View in Genome Browser
Species Human (GRCh38)
Location 19:51693523-51693545
Sequence CACGATGGCCCTGCTGGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167793288_1167793298 29 Left 1167793288 19:51693471-51693493 CCTGTGGTGACTTCATAAAGGTT No data
Right 1167793298 19:51693523-51693545 CACGATGGCCCTGCTGGCTCTGG No data
1167793291_1167793298 -5 Left 1167793291 19:51693505-51693527 CCCTGGCCTTGAGACCCACACGA No data
Right 1167793298 19:51693523-51693545 CACGATGGCCCTGCTGGCTCTGG No data
1167793287_1167793298 30 Left 1167793287 19:51693470-51693492 CCCTGTGGTGACTTCATAAAGGT No data
Right 1167793298 19:51693523-51693545 CACGATGGCCCTGCTGGCTCTGG No data
1167793292_1167793298 -6 Left 1167793292 19:51693506-51693528 CCTGGCCTTGAGACCCACACGAT No data
Right 1167793298 19:51693523-51693545 CACGATGGCCCTGCTGGCTCTGG No data
1167793290_1167793298 -4 Left 1167793290 19:51693504-51693526 CCCCTGGCCTTGAGACCCACACG No data
Right 1167793298 19:51693523-51693545 CACGATGGCCCTGCTGGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167793298 Original CRISPR CACGATGGCCCTGCTGGCTC TGG Intergenic
No off target data available for this crispr