ID: 1167793300

View in Genome Browser
Species Human (GRCh38)
Location 19:51693532-51693554
Sequence CGGCACTGGCCAGAGCCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167793300_1167793309 12 Left 1167793300 19:51693532-51693554 CCTGCTGGCTCTGGCCAGTGCCG No data
Right 1167793309 19:51693567-51693589 TGCTGGCCCTGGCTGTCTTCAGG No data
1167793300_1167793302 -5 Left 1167793300 19:51693532-51693554 CCTGCTGGCTCTGGCCAGTGCCG No data
Right 1167793302 19:51693550-51693572 TGCCGTCCCGTCTGCCCTGCTGG No data
1167793300_1167793313 24 Left 1167793300 19:51693532-51693554 CCTGCTGGCTCTGGCCAGTGCCG No data
Right 1167793313 19:51693579-51693601 CTGTCTTCAGGGTGCCCGCCTGG No data
1167793300_1167793305 1 Left 1167793300 19:51693532-51693554 CCTGCTGGCTCTGGCCAGTGCCG No data
Right 1167793305 19:51693556-51693578 CCCGTCTGCCCTGCTGGCCCTGG No data
1167793300_1167793310 13 Left 1167793300 19:51693532-51693554 CCTGCTGGCTCTGGCCAGTGCCG No data
Right 1167793310 19:51693568-51693590 GCTGGCCCTGGCTGTCTTCAGGG No data
1167793300_1167793314 25 Left 1167793300 19:51693532-51693554 CCTGCTGGCTCTGGCCAGTGCCG No data
Right 1167793314 19:51693580-51693602 TGTCTTCAGGGTGCCCGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167793300 Original CRISPR CGGCACTGGCCAGAGCCAGC AGG (reversed) Intergenic
No off target data available for this crispr