ID: 1167793305

View in Genome Browser
Species Human (GRCh38)
Location 19:51693556-51693578
Sequence CCCGTCTGCCCTGCTGGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167793300_1167793305 1 Left 1167793300 19:51693532-51693554 CCTGCTGGCTCTGGCCAGTGCCG No data
Right 1167793305 19:51693556-51693578 CCCGTCTGCCCTGCTGGCCCTGG No data
1167793296_1167793305 14 Left 1167793296 19:51693519-51693541 CCCACACGATGGCCCTGCTGGCT No data
Right 1167793305 19:51693556-51693578 CCCGTCTGCCCTGCTGGCCCTGG No data
1167793292_1167793305 27 Left 1167793292 19:51693506-51693528 CCTGGCCTTGAGACCCACACGAT No data
Right 1167793305 19:51693556-51693578 CCCGTCTGCCCTGCTGGCCCTGG No data
1167793297_1167793305 13 Left 1167793297 19:51693520-51693542 CCACACGATGGCCCTGCTGGCTC No data
Right 1167793305 19:51693556-51693578 CCCGTCTGCCCTGCTGGCCCTGG No data
1167793299_1167793305 2 Left 1167793299 19:51693531-51693553 CCCTGCTGGCTCTGGCCAGTGCC No data
Right 1167793305 19:51693556-51693578 CCCGTCTGCCCTGCTGGCCCTGG No data
1167793294_1167793305 22 Left 1167793294 19:51693511-51693533 CCTTGAGACCCACACGATGGCCC No data
Right 1167793305 19:51693556-51693578 CCCGTCTGCCCTGCTGGCCCTGG No data
1167793291_1167793305 28 Left 1167793291 19:51693505-51693527 CCCTGGCCTTGAGACCCACACGA No data
Right 1167793305 19:51693556-51693578 CCCGTCTGCCCTGCTGGCCCTGG No data
1167793290_1167793305 29 Left 1167793290 19:51693504-51693526 CCCCTGGCCTTGAGACCCACACG No data
Right 1167793305 19:51693556-51693578 CCCGTCTGCCCTGCTGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167793305 Original CRISPR CCCGTCTGCCCTGCTGGCCC TGG Intergenic
No off target data available for this crispr