ID: 1167793309

View in Genome Browser
Species Human (GRCh38)
Location 19:51693567-51693589
Sequence TGCTGGCCCTGGCTGTCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167793301_1167793309 -2 Left 1167793301 19:51693546-51693568 CCAGTGCCGTCCCGTCTGCCCTG No data
Right 1167793309 19:51693567-51693589 TGCTGGCCCTGGCTGTCTTCAGG No data
1167793300_1167793309 12 Left 1167793300 19:51693532-51693554 CCTGCTGGCTCTGGCCAGTGCCG No data
Right 1167793309 19:51693567-51693589 TGCTGGCCCTGGCTGTCTTCAGG No data
1167793297_1167793309 24 Left 1167793297 19:51693520-51693542 CCACACGATGGCCCTGCTGGCTC No data
Right 1167793309 19:51693567-51693589 TGCTGGCCCTGGCTGTCTTCAGG No data
1167793296_1167793309 25 Left 1167793296 19:51693519-51693541 CCCACACGATGGCCCTGCTGGCT No data
Right 1167793309 19:51693567-51693589 TGCTGGCCCTGGCTGTCTTCAGG No data
1167793303_1167793309 -8 Left 1167793303 19:51693552-51693574 CCGTCCCGTCTGCCCTGCTGGCC No data
Right 1167793309 19:51693567-51693589 TGCTGGCCCTGGCTGTCTTCAGG No data
1167793299_1167793309 13 Left 1167793299 19:51693531-51693553 CCCTGCTGGCTCTGGCCAGTGCC No data
Right 1167793309 19:51693567-51693589 TGCTGGCCCTGGCTGTCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167793309 Original CRISPR TGCTGGCCCTGGCTGTCTTC AGG Intergenic
No off target data available for this crispr