ID: 1167793314

View in Genome Browser
Species Human (GRCh38)
Location 19:51693580-51693602
Sequence TGTCTTCAGGGTGCCCGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167793301_1167793314 11 Left 1167793301 19:51693546-51693568 CCAGTGCCGTCCCGTCTGCCCTG No data
Right 1167793314 19:51693580-51693602 TGTCTTCAGGGTGCCCGCCTGGG No data
1167793303_1167793314 5 Left 1167793303 19:51693552-51693574 CCGTCCCGTCTGCCCTGCTGGCC No data
Right 1167793314 19:51693580-51693602 TGTCTTCAGGGTGCCCGCCTGGG No data
1167793307_1167793314 -7 Left 1167793307 19:51693564-51693586 CCCTGCTGGCCCTGGCTGTCTTC No data
Right 1167793314 19:51693580-51693602 TGTCTTCAGGGTGCCCGCCTGGG No data
1167793300_1167793314 25 Left 1167793300 19:51693532-51693554 CCTGCTGGCTCTGGCCAGTGCCG No data
Right 1167793314 19:51693580-51693602 TGTCTTCAGGGTGCCCGCCTGGG No data
1167793306_1167793314 0 Left 1167793306 19:51693557-51693579 CCGTCTGCCCTGCTGGCCCTGGC No data
Right 1167793314 19:51693580-51693602 TGTCTTCAGGGTGCCCGCCTGGG No data
1167793299_1167793314 26 Left 1167793299 19:51693531-51693553 CCCTGCTGGCTCTGGCCAGTGCC No data
Right 1167793314 19:51693580-51693602 TGTCTTCAGGGTGCCCGCCTGGG No data
1167793308_1167793314 -8 Left 1167793308 19:51693565-51693587 CCTGCTGGCCCTGGCTGTCTTCA No data
Right 1167793314 19:51693580-51693602 TGTCTTCAGGGTGCCCGCCTGGG No data
1167793304_1167793314 1 Left 1167793304 19:51693556-51693578 CCCGTCTGCCCTGCTGGCCCTGG No data
Right 1167793314 19:51693580-51693602 TGTCTTCAGGGTGCCCGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167793314 Original CRISPR TGTCTTCAGGGTGCCCGCCT GGG Intergenic
No off target data available for this crispr