ID: 1167796945

View in Genome Browser
Species Human (GRCh38)
Location 19:51715656-51715678
Sequence TGAAATACCCAGAGGAAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 215}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167796945_1167796950 23 Left 1167796945 19:51715656-51715678 CCAAGTTTCCTCTGGGTATTTCA 0: 1
1: 0
2: 1
3: 17
4: 215
Right 1167796950 19:51715702-51715724 ACTCTCCCCTGAACTTCACTTGG 0: 1
1: 0
2: 1
3: 18
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167796945 Original CRISPR TGAAATACCCAGAGGAAACT TGG (reversed) Intronic
900808557 1:4784089-4784111 TAAACTACCCAGTGGAAACAGGG + Exonic
901863292 1:12088350-12088372 AGAAATCCAGAGAGGAAACTTGG + Intronic
902066339 1:13691251-13691273 TGAAATATCTAGAGAGAACTTGG - Intergenic
904959290 1:34318747-34318769 TGAAAGAGACAGAGAAAACTGGG + Intergenic
905629987 1:39513100-39513122 AGCATTTCCCAGAGGAAACTGGG + Intronic
905667772 1:39773090-39773112 AGCATTTCCCAGAGGAAACTGGG - Intronic
905938106 1:41840760-41840782 CGACATAACCAGAGGAAGCTTGG + Intronic
906338766 1:44959197-44959219 TGTACTATCCAAAGGAAACTTGG - Intronic
908701179 1:66902645-66902667 TAAAATTCCTAGAGGAAAATAGG - Intronic
908808713 1:67957573-67957595 TGTAAATCCCAGAGGAAACTAGG - Intergenic
908959556 1:69679185-69679207 GCAAATACCATGAGGAAACTTGG - Intronic
910772671 1:90845593-90845615 TTAAATACACAGAGGAAAGAAGG + Intergenic
911662013 1:100511523-100511545 GGTAACACCCAGAGGAAGCTGGG - Intronic
913536086 1:119773974-119773996 TGAAAGGTCCAGAGGAAAGTAGG + Intergenic
923380955 1:233417302-233417324 TGACATACCTGGTGGAAACTGGG + Intergenic
923749882 1:236737691-236737713 ATAAATACCCAGAGGAAATCTGG + Intronic
1063888847 10:10608231-10608253 GGAATTACCCAGAAGATACTTGG + Intergenic
1064632365 10:17329489-17329511 TGAAATAGCCTGAGGTATCTAGG - Intronic
1064794735 10:18998647-18998669 AGAAATGCACAGAGGAAATTTGG + Intergenic
1064844946 10:19641387-19641409 TGAAATACAAAAAGGAAACAAGG + Intronic
1065600352 10:27361691-27361713 AAAAATACCCGGAAGAAACTAGG - Intergenic
1065831342 10:29617098-29617120 GGAAATACACGGGGGAAACTAGG - Intronic
1072254062 10:93603666-93603688 TGATATACCCAGTGGAAAAGTGG - Intronic
1073050384 10:100663247-100663269 TTAAACACCCAGAAGAAACAGGG - Intergenic
1074004188 10:109403110-109403132 TGACATTCCCAGAGGAAAAGAGG - Intergenic
1075701644 10:124473595-124473617 GGAATTACACATAGGAAACTGGG - Intronic
1075833220 10:125428682-125428704 TCAAATGCCCAGGGGAAAGTGGG + Intergenic
1075972466 10:126666262-126666284 TGAAATACCCTGGGGATATTTGG - Intronic
1076303989 10:129450346-129450368 TTAGTTACCCAGAGGAAAGTAGG + Intergenic
1076359125 10:129874571-129874593 TGCAAGACCCAGATGAAACCTGG - Intronic
1078033795 11:7781240-7781262 TGAAAAATCCATAGGCAACTAGG + Intergenic
1078985424 11:16590154-16590176 TGAAAGACACATAGAAAACTTGG + Intronic
1080060925 11:27956004-27956026 AGAAATACCCACAGGAGACTAGG + Intergenic
1081051114 11:38342858-38342880 TGAAATACAGCAAGGAAACTAGG - Intergenic
1084897332 11:72282963-72282985 GTAAATACCCAGAGGATTCTGGG - Intergenic
1085233568 11:74993539-74993561 TGAAATACTCACATGAAGCTAGG + Intronic
1085679628 11:78560954-78560976 TGAAAAATCCAAAGGAAACGAGG + Intronic
1086520600 11:87664017-87664039 GGAAATACCCAGAGCACAGTTGG - Intergenic
1087952905 11:104246346-104246368 TGAAACAAATAGAGGAAACTAGG - Intergenic
1089099315 11:115947935-115947957 TGACAGACCCAGAGCCAACTGGG - Intergenic
1089676537 11:120093899-120093921 TGTAATACCCACAGGAATGTTGG + Intergenic
1089985430 11:122808468-122808490 TGAATTTCCCTGAGGGAACTTGG + Intronic
1090490174 11:127153696-127153718 TGAACTACACAGATGAAATTCGG + Intergenic
1092323447 12:7503902-7503924 TGAAACAACCAAAGGAAATTGGG + Intergenic
1093990871 12:25588820-25588842 TCAAATACTCAGAAGAAAATGGG + Intronic
1094524043 12:31219981-31220003 TGGATTCCCCAGAGGAAACAGGG - Intergenic
1094767672 12:33617009-33617031 TGAGACACCTAGAGGAAATTGGG - Intergenic
1096407038 12:51351403-51351425 TGAGAAACCCAGAGGACATTGGG - Exonic
1097917827 12:65039157-65039179 AGAAACACCAAGAAGAAACTTGG - Intergenic
1100185533 12:92135073-92135095 TGAAAAACCCATAGCAAATTGGG + Intronic
1101809023 12:108091864-108091886 TTAAATCCCCAAAGTAAACTTGG - Intergenic
1103456646 12:121072282-121072304 GGCAAAATCCAGAGGAAACTAGG - Intergenic
1104747061 12:131217193-131217215 TGTCAGACCCAGAGGAAACAGGG + Intergenic
1108149276 13:47514956-47514978 TGAAATACCCAAAGAAGACAAGG + Intergenic
1108740173 13:53329483-53329505 TTAAATACCAGGAAGAAACTGGG - Intergenic
1108829138 13:54454744-54454766 TCAAATACACAGAGGAAAATAGG + Intergenic
1108926016 13:55746175-55746197 TGATATACCTAGAGGAATCTAGG + Intergenic
1110299235 13:73906870-73906892 TGAGATACCCAGATTAAAGTAGG - Intronic
1110476867 13:75926248-75926270 TGAAATAACAAGATGAAACTAGG - Intergenic
1110749748 13:79098853-79098875 GGAAATACACAGAGGGAACTAGG - Intergenic
1110879291 13:80551373-80551395 GGAAAAACTCAGAGGAAAATGGG + Intergenic
1111552460 13:89832864-89832886 TGAAATACACATAGGAAAAAAGG - Intergenic
1111639674 13:90951727-90951749 AGCAAAACCCAGAGAAAACTGGG + Intergenic
1111781461 13:92731395-92731417 TGAAATAATGAGAGAAAACTGGG + Intronic
1114175164 14:20311721-20311743 TGTATTATCCAAAGGAAACTTGG + Exonic
1117206296 14:53447181-53447203 TCATTTACCAAGAGGAAACTAGG + Intergenic
1117222124 14:53616867-53616889 GGAAATTCCCAAAGGAAACTGGG + Intergenic
1117779667 14:59219430-59219452 TGCTATACCCAGAAGAAACCAGG - Intronic
1118615156 14:67569937-67569959 AGAAAGACCCAGGGGAAACAAGG - Exonic
1118863025 14:69680226-69680248 TCAAGTATCCAGTGGAAACTGGG - Intronic
1120832107 14:89006688-89006710 TGAAAACCCCAGATGAAACCAGG + Intergenic
1121395033 14:93613938-93613960 TGAAACACACAGAGAAAACAAGG - Intronic
1123932146 15:25177133-25177155 TGAAAGACACAGAGGATAATGGG - Intergenic
1125018957 15:34966387-34966409 TGAAATGCAGAGAGGAAAGTGGG - Intronic
1126443396 15:48716397-48716419 TGAAATGCCCATAGAAAATTGGG - Intronic
1127537062 15:59900120-59900142 TGACAGACTCAGAGGAGACTGGG - Intergenic
1130710017 15:86270884-86270906 TGGAATCCTCAGAGGAAACATGG - Intronic
1133377505 16:5299969-5299991 TAAAAAACCCTCAGGAAACTAGG - Intergenic
1133848597 16:9480361-9480383 TGAAATGCCCAGCAGAAAGTGGG - Intergenic
1133990132 16:10700082-10700104 TAAAATCCCCAGAGGATATTAGG + Intergenic
1139085432 16:63579601-63579623 TAAGATACCCAGAGGCCACTGGG + Intergenic
1142951352 17:3483578-3483600 TGACTTACCCACAGGATACTTGG - Exonic
1146087884 17:29847172-29847194 TGTTATACCCATAGGAGACTGGG - Intronic
1147272495 17:39285280-39285302 TGAAATGACTAGAGGTAACTAGG - Intronic
1147309120 17:39583844-39583866 ATTAATACCCAGAGGAAGCTAGG + Intergenic
1148327369 17:46790966-46790988 GGAAAACCCCAGAGGAAACGAGG - Intronic
1149573313 17:57692542-57692564 TAAGATACCCAAAGAAAACTTGG - Intergenic
1150918027 17:69456182-69456204 AGAAACATCCAGAGCAAACTGGG + Intronic
1154245967 18:12698979-12699001 TGAAGTACACAGAGAAAGCTTGG - Exonic
1154482221 18:14842709-14842731 AGAAATACACTGAAGAAACTAGG - Intronic
1155095269 18:22549378-22549400 AGAAATACCCTGAGGGCACTGGG - Intergenic
1156358748 18:36365139-36365161 TGAAACTCCCAGAGGAAAACAGG + Intronic
1156393631 18:36676831-36676853 CAAACTACCCAGAGGAAAATGGG - Intronic
1157943204 18:51951552-51951574 AGAAATACCCAGATGAAGGTTGG + Intergenic
1159056041 18:63465015-63465037 GGAAAGAGCCAGAGGAAAGTGGG - Intergenic
1159990154 18:74896920-74896942 TGAAATGGGCAGAGAAAACTAGG - Intronic
1164576377 19:29407657-29407679 GGAAAAATCCAGGGGAAACTTGG + Intergenic
1165407227 19:35638214-35638236 GGAAAGCCCCAGAGGAGACTTGG - Intergenic
1167796945 19:51715656-51715678 TGAAATACCCAGAGGAAACTTGG - Intronic
926223464 2:10951394-10951416 TGAATTGCCCTGAGGAAACCAGG - Intergenic
926563820 2:14447037-14447059 TGAAATACATGAAGGAAACTTGG + Intergenic
926752804 2:16211772-16211794 TCAAAGACCCAGGGAAAACTGGG + Intergenic
927115562 2:19898411-19898433 TGACATATCCATAGCAAACTCGG - Intronic
927426943 2:22991578-22991600 TAAAATACACAGGAGAAACTAGG - Intergenic
928395995 2:30943760-30943782 AGAGATACCAAGAGGAAAATTGG - Intronic
929993737 2:46812046-46812068 TGAAGGTCCCAGAGGAAATTGGG - Intergenic
930833392 2:55769782-55769804 TGAAGAACCCAGAGGAGGCTGGG + Intergenic
931017766 2:58005775-58005797 TGGAAGACCCAGATGAAGCTAGG + Intronic
932165270 2:69499403-69499425 TGAAAGTCCCAGAGGGAACTAGG - Intronic
932188869 2:69721780-69721802 TAAAAGAGCCAGAGGAGACTGGG - Intronic
933751300 2:85603465-85603487 TGAGAGACCCGGAGGAATCTGGG + Intronic
934979141 2:98825936-98825958 TGAAGTACCCAGGGCAAGCTGGG - Intronic
937936748 2:127251753-127251775 TGAAAAACACAAAGGAAACAGGG + Intergenic
938926941 2:136052101-136052123 TGGAATACACAGAGGGAGCTGGG + Intergenic
940577027 2:155521845-155521867 TAAAATACTCAGAGGCAAATCGG - Intergenic
940927750 2:159385685-159385707 TAAAATATCCAGATGAAACTTGG - Intronic
941039875 2:160609211-160609233 TGAAATAACCAGAGGACTTTGGG - Intergenic
941350416 2:164425939-164425961 AGAAATTCCCAGAGGAAAACTGG + Intergenic
943340877 2:186680666-186680688 TGAAATATCCTAAGGTAACTTGG + Exonic
943366021 2:186968155-186968177 AGCAGTAACCAGAGGAAACTTGG - Intergenic
944352408 2:198744595-198744617 TGAAAGACCCAGAGAAGTCTGGG + Intergenic
945441152 2:209881819-209881841 TGAAAGAACCACTGGAAACTTGG - Intronic
945976063 2:216271773-216271795 AGAAATATTCAGAGGAACCTGGG - Intronic
946343044 2:219084465-219084487 TGAATTACCCACAGGTTACTGGG - Intronic
948471375 2:238182767-238182789 AGAAATAGCAAGAGGAAAATTGG - Intronic
1169933282 20:10856767-10856789 TGAAATAAAAAGAGGAATCTGGG - Intergenic
1170530940 20:17290879-17290901 TGAGATAGCGAGAGGAAACGGGG + Intronic
1174669620 20:52294274-52294296 GGAAATACCCAGAAGAAGGTGGG + Intergenic
1175307920 20:57990596-57990618 TACAATGCCCAGAGGAAACATGG + Intergenic
1176184687 20:63771778-63771800 GGAAATACTCAGAAAAAACTTGG - Intronic
1176798383 21:13393915-13393937 AGAAATACACTGAAGAAACTAGG + Intergenic
1176894426 21:14359828-14359850 TGAAATACTCAGCTGAAACTGGG + Intergenic
1177478731 21:21658250-21658272 TGAAAGACCCATAGAAAAATTGG - Intergenic
1178489360 21:33038735-33038757 TGAAAATGCCAGAGGAAAGTTGG - Intergenic
1178813496 21:35905825-35905847 TAAAATACCCAGCGAATACTTGG + Intronic
1184491137 22:44809757-44809779 AGGAAAACCCAGAGGAATCTAGG - Intronic
1184972180 22:48031829-48031851 TGGAATGGCCAGAGGAAAGTGGG - Intergenic
950171130 3:10839710-10839732 TGCAATGCCCAGAGGCTACTGGG - Intronic
951790268 3:26474796-26474818 TGAATTACTCAGAGGAAAGAGGG - Intergenic
955825641 3:62944218-62944240 TGTATCACCCAGAGGAAAATCGG - Intergenic
955882730 3:63565141-63565163 TGGCATACCCAGAGAAAACTTGG + Intronic
956055083 3:65290210-65290232 TGAAAAATATAGAGGAAACTCGG + Intergenic
956704060 3:71984107-71984129 TGTGATGCCCAGAGGAGACTGGG + Intergenic
958134345 3:89468169-89468191 TGAAATCCCCAGAGAAATCCTGG + Intronic
958703386 3:97621635-97621657 TGGAATACCCAAAGGTAACTAGG + Intronic
960015333 3:112881422-112881444 TTAAAAACCCAAAGGAAACTGGG - Intergenic
962426336 3:135272042-135272064 TGCAGTACCCAGAGGAGCCTGGG - Intergenic
965280843 3:166750601-166750623 TGAAAGTATCAGAGGAAACTTGG - Intergenic
967470541 3:189856392-189856414 AGAAGTACCTAGAAGAAACTTGG + Intronic
967701894 3:192602995-192603017 ATAAAAACCCACAGGAAACTAGG + Intronic
968849215 4:3067135-3067157 AGAAATAGCCAGAGAGAACTAGG + Intergenic
969043134 4:4316749-4316771 GCATATAACCAGAGGAAACTCGG + Intronic
969251096 4:5969425-5969447 ACAAATACCCAGAGGAAAGCAGG + Intronic
969385668 4:6845292-6845314 TGACGTGCCCAGAGAAAACTTGG + Intronic
969494224 4:7516692-7516714 TGAAGTTCCCAGAAGGAACTGGG + Intronic
971678981 4:29672518-29672540 TGAAATAAACATAGGAATCTTGG - Intergenic
974432355 4:61815756-61815778 TAAAAGGCCTAGAGGAAACTAGG + Intronic
974890219 4:67872679-67872701 TCAATTACGCACAGGAAACTTGG - Intronic
975752463 4:77538126-77538148 TAAAATATCCAGAGGTATCTTGG - Intronic
976816472 4:89153329-89153351 TGAAATAACAAGAGGAAAAGAGG - Intergenic
980343520 4:131583183-131583205 TGAAATGCCCAGGGGGTACTGGG + Intergenic
981585074 4:146291834-146291856 TGTACCACCCAGAGGACACTTGG + Intronic
984460936 4:180035795-180035817 GGAAATACCCTGGGCAAACTAGG - Intergenic
988513451 5:31885089-31885111 TAAAATACCCAGAAGAAAAACGG + Intronic
990775012 5:59296541-59296563 TGAAGTACCCAGTGGACAGTAGG - Intronic
992073118 5:73166829-73166851 TTTATTACCAAGAGGAAACTAGG - Intergenic
993009366 5:82462444-82462466 AGAAAAACCCTGAAGAAACTGGG + Intergenic
996871591 5:128198938-128198960 AGAATTACCCACGGGAAACTGGG + Intergenic
997184543 5:131868504-131868526 TGAAAAACCCAGTGAAAAATGGG - Intronic
997605657 5:135174097-135174119 TGAACTATCCAGAGGCAGCTTGG - Exonic
999200489 5:149812865-149812887 TCAGCTTCCCAGAGGAAACTCGG + Intronic
1001246582 5:170109457-170109479 TGACATGCACACAGGAAACTGGG - Intronic
1003548793 6:7083926-7083948 GAAACCACCCAGAGGAAACTGGG - Intergenic
1004409462 6:15367062-15367084 GGAAATACCTCGTGGAAACTGGG - Intronic
1004743166 6:18483138-18483160 TAAAATATCTGGAGGAAACTAGG - Intergenic
1006020105 6:31112722-31112744 TGAATGTCCCAGAGGAAGCTGGG + Intergenic
1008558299 6:52697120-52697142 TAAAATACACAAAGGAAAGTTGG + Intergenic
1010166780 6:72924295-72924317 TGAACTAATCACAGGAAACTAGG + Intronic
1010459291 6:76095765-76095787 TTAAAAACCCTGAAGAAACTGGG + Intergenic
1010566101 6:77416149-77416171 TGAAATACCCTGAGGGACGTGGG - Intergenic
1015453306 6:133395844-133395866 TGAGATACCAAGTGTAAACTGGG - Intronic
1015694040 6:135959670-135959692 TGAAATGCCAAGAGGACTCTGGG + Intronic
1015793845 6:136990656-136990678 TAAAAGAACCAGAGGAAACTCGG - Intergenic
1016779602 6:147943484-147943506 TGAAATACGCAGAGCAAAGGAGG - Intergenic
1017456785 6:154607825-154607847 TGAAAAAAGCAGAGGAAACCTGG - Intergenic
1019264831 7:109079-109101 AGGAAGACCCAGAGGAAACTCGG + Intergenic
1019270397 7:143897-143919 TGAAGTCTGCAGAGGAAACTGGG + Intergenic
1019603456 7:1896595-1896617 TGAAACACCGAAAGGAAACACGG + Intronic
1022902702 7:34826355-34826377 AGAAAAATCTAGAGGAAACTAGG - Intronic
1023186362 7:37537266-37537288 AGAACTACCCAGAGGAAGCGAGG - Intergenic
1024058975 7:45684143-45684165 TGAAATACCCAATGGTATCTTGG + Intronic
1026378403 7:69774880-69774902 TGATATCTCCAGAGGAACCTAGG + Intronic
1026948272 7:74330222-74330244 AGAAACACCAAGAGGAAGCTAGG - Intronic
1027808550 7:82861805-82861827 AGAAATAACCAGAGGAATTTTGG + Intronic
1028039194 7:86026451-86026473 TGAAATATGCAGAGGAAAGGGGG - Intergenic
1030531270 7:110714108-110714130 AGAAAAACCCTGAAGAAACTAGG - Intronic
1031289221 7:119911043-119911065 TAAAACTCCCAGAAGAAACTAGG - Intergenic
1031542074 7:123006634-123006656 TGAAATAGCAAGAAGAAACAGGG - Intergenic
1033414611 7:141151110-141151132 TGAAGGACACAGAGGAAAATGGG + Intronic
1033677630 7:143558624-143558646 TGAAAAGCCCAAAGGAAAGTGGG + Intergenic
1033694204 7:143770816-143770838 TGAAAAGCCCAAAGGAAAGTGGG - Intergenic
1033888206 7:145974687-145974709 AGACAAACCCAGAAGAAACTTGG + Intergenic
1034635550 7:152564622-152564644 AGAAATGGCCAGAGGAGACTAGG - Intergenic
1036005803 8:4662309-4662331 TGAATTACTCAGAGGAAATGAGG + Intronic
1037518692 8:19659170-19659192 TGAGATACCCTGATTAAACTTGG - Intronic
1039506600 8:38056956-38056978 TGAAAAACCCAGAGGAGGCTGGG - Intronic
1046611918 8:116435344-116435366 TCAAATACCCAGAGAAAGATTGG + Intergenic
1047876073 8:129138955-129138977 TGAAATACTCCAAGTAAACTGGG + Intergenic
1048163555 8:132041941-132041963 TGAAATACCCTAAGGAACTTAGG - Intronic
1048735472 8:137495232-137495254 TGAAATATCCAGAGGATACTAGG + Intergenic
1049660233 8:143816465-143816487 TATAAAACCCAGAGGAAACAAGG + Exonic
1049941746 9:552578-552600 TGAATGAACCAGAAGAAACTTGG + Intronic
1050245072 9:3680863-3680885 TGAAAGACACAGAGGAAACCAGG + Intergenic
1051132829 9:13881688-13881710 TGAAATTCACAGAGGACAGTGGG - Intergenic
1055582792 9:77725533-77725555 TATAATGCACAGAGGAAACTTGG - Intronic
1055804072 9:80073668-80073690 GTAAATACCCAGAGAAAAGTGGG - Intergenic
1057360249 9:94366808-94366830 TGCAATACGGAAAGGAAACTTGG + Intergenic
1057453184 9:95183566-95183588 TAAAATACCCACAGAATACTGGG + Intronic
1057760150 9:97866363-97866385 TGAAAAACTCTCAGGAAACTAGG - Intergenic
1058500550 9:105610999-105611021 TGAAAAACCAAAAGGAAAGTTGG + Intronic
1188927200 X:36058834-36058856 TGAAATGACCATAGGAAATTAGG - Intronic
1189000858 X:36943648-36943670 TGAAATACTCAGATGAAATGAGG + Intergenic
1190914381 X:54799469-54799491 GGAAATCCTGAGAGGAAACTTGG - Intergenic
1191773126 X:64784074-64784096 TTAAATACCTAGAGGAGTCTAGG + Intergenic
1193364296 X:80612493-80612515 TTAAAAACCCTCAGGAAACTAGG + Intergenic
1193658806 X:84231640-84231662 TGAAGTAGCTAGAGGAAAGTGGG + Intergenic
1194092410 X:89594400-89594422 TGAAATACTCACAGGAAATATGG + Intergenic
1194957681 X:100200006-100200028 GGAAATACCCACAGAAAAGTGGG + Intergenic
1195693631 X:107650076-107650098 TCAAATACCAAGGGGAAACAAGG - Exonic
1196098111 X:111821257-111821279 TCAAATACCCAGGGGGAAATTGG + Intronic
1196744091 X:119053152-119053174 TGAAATAACAAGAGAAAATTAGG + Intergenic
1198562760 X:137868662-137868684 GGAAAAACACAGAGGAAACAAGG + Intergenic
1199722163 X:150549692-150549714 AGTGCTACCCAGAGGAAACTTGG - Intergenic
1200445042 Y:3250437-3250459 TGAAATACTCACAGGAAATATGG + Intergenic