ID: 1167800904

View in Genome Browser
Species Human (GRCh38)
Location 19:51741091-51741113
Sequence CAGGTAGGTTACCTGAGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167800904_1167800908 -1 Left 1167800904 19:51741091-51741113 CCTGACCTCAGGTAACCTACCTG No data
Right 1167800908 19:51741113-51741135 GCCTCAGCCTCCCAAAGTGCTGG 0: 56931
1: 168651
2: 218048
3: 269456
4: 306914
1167800904_1167800910 0 Left 1167800904 19:51741091-51741113 CCTGACCTCAGGTAACCTACCTG No data
Right 1167800910 19:51741114-51741136 CCTCAGCCTCCCAAAGTGCTGGG 0: 90349
1: 212695
2: 235979
3: 260133
4: 296590

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167800904 Original CRISPR CAGGTAGGTTACCTGAGGTC AGG (reversed) Intergenic
No off target data available for this crispr