ID: 1167804006

View in Genome Browser
Species Human (GRCh38)
Location 19:51766594-51766616
Sequence GGGGAATCCCTTTCAAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 111}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167803997_1167804006 12 Left 1167803997 19:51766559-51766581 CCAGACTGAGGCATAGCCCTATC 0: 1
1: 0
2: 0
3: 2
4: 58
Right 1167804006 19:51766594-51766616 GGGGAATCCCTTTCAAAGGCAGG 0: 1
1: 0
2: 0
3: 9
4: 111
1167804001_1167804006 -4 Left 1167804001 19:51766575-51766597 CCCTATCCTAGTAATCTTGGGGG 0: 1
1: 0
2: 0
3: 13
4: 380
Right 1167804006 19:51766594-51766616 GGGGAATCCCTTTCAAAGGCAGG 0: 1
1: 0
2: 0
3: 9
4: 111
1167804004_1167804006 -10 Left 1167804004 19:51766581-51766603 CCTAGTAATCTTGGGGGAATCCC 0: 1
1: 0
2: 0
3: 4
4: 61
Right 1167804006 19:51766594-51766616 GGGGAATCCCTTTCAAAGGCAGG 0: 1
1: 0
2: 0
3: 9
4: 111
1167804003_1167804006 -5 Left 1167804003 19:51766576-51766598 CCTATCCTAGTAATCTTGGGGGA 0: 1
1: 0
2: 0
3: 12
4: 230
Right 1167804006 19:51766594-51766616 GGGGAATCCCTTTCAAAGGCAGG 0: 1
1: 0
2: 0
3: 9
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167804006 Original CRISPR GGGGAATCCCTTTCAAAGGC AGG Intronic
901762995 1:11482669-11482691 GGGGAAACCATTTCAAAGAGGGG - Intronic
908742362 1:67342010-67342032 GAGGAATCCCTATTAGAGGCTGG - Intronic
910089808 1:83449176-83449198 GGAAATTCCCTTCCAAAGGCAGG - Intergenic
911581252 1:99635883-99635905 AGGGACTCCCTTTAGAAGGCTGG + Intergenic
915728047 1:158032736-158032758 GGGGATTCCCCATCACAGGCTGG - Intronic
918660106 1:187077862-187077884 GGGGAATGCTTTACAGAGGCAGG + Intergenic
918719788 1:187838585-187838607 GGGGAATTCCCTTCAAAGAGAGG + Intergenic
919381784 1:196869438-196869460 GGGCACTCCCTTGCAGAGGCTGG - Intronic
920253602 1:204638997-204639019 GGGGAAAGACTTTCAAAGGTGGG - Intronic
1063578434 10:7282952-7282974 GAGGTTTCCCATTCAAAGGCCGG + Intronic
1065464588 10:26005796-26005818 GGGGAAACCATTTTAAAAGCTGG + Intronic
1067530724 10:47069812-47069834 GGAGATTCCCTTTCCAAGGAAGG - Intergenic
1068810182 10:61246646-61246668 GTTGAATCCCTTCCAAATGCAGG - Intergenic
1071541933 10:86493088-86493110 GGGGAATTTTTTTCAAAGGGGGG + Intronic
1071545234 10:86523829-86523851 GGGGAATCCTGTTAAAATGCAGG - Intergenic
1074086495 10:110211758-110211780 GGGGATTCCCTAGGAAAGGCAGG + Intronic
1075389742 10:122083824-122083846 AGGGAATCAGTTTCCAAGGCTGG + Exonic
1078945073 11:16056612-16056634 GTGGAATCCCAGGCAAAGGCAGG - Intronic
1079135303 11:17773084-17773106 GGAGGGTCCCTTGCAAAGGCAGG + Intronic
1083412120 11:62501223-62501245 TGGAAATCCCTTTGAAAGGCAGG - Intronic
1084838060 11:71819803-71819825 GAGAAATCCCTTTCAATGTCCGG + Intergenic
1085032704 11:73282324-73282346 GGGAGATCCCTTTCTAAAGCAGG - Intronic
1092400645 12:8174272-8174294 GAGAAATCCCTTTCAATGTCCGG - Intronic
1094627666 12:32140017-32140039 AGGGAATCCACTACAAAGGCAGG - Intronic
1096262807 12:50103612-50103634 GGGGAATGCTTTTCAGAGGTAGG - Intergenic
1097938347 12:65278392-65278414 GGGGCATCCCTTTCCAACTCGGG - Intergenic
1101350692 12:103927780-103927802 AGGGAATCCGATACAAAGGCAGG + Intergenic
1102807716 12:115796500-115796522 TGGGAAACCCATTCACAGGCAGG - Intergenic
1105326328 13:19373662-19373684 GGGGACTCCTGTGCAAAGGCAGG + Intergenic
1106531142 13:30592966-30592988 AGGCAATCCCTTTCAGAGACTGG - Intronic
1106776548 13:33015841-33015863 GGGGAATCCCTTTCAGCGCACGG + Intergenic
1113585528 13:111461867-111461889 GAGGAAGCCCTTTCCAGGGCAGG - Intergenic
1114538042 14:23435554-23435576 GAGGAATCCCTTCCTAAGCCTGG + Intronic
1128219277 15:65956662-65956684 GTGGAATCCTGTTCAAAGGCAGG - Intronic
1128809055 15:70556668-70556690 GGGCCATCCCTTGCAAAAGCTGG - Intergenic
1130909153 15:88259072-88259094 AGGGAAGCCCTTTCAAAAGCAGG + Intergenic
1132554675 16:567213-567235 GTGGAACCCCTTTCTACGGCGGG - Intronic
1133377082 16:5296040-5296062 GGGAGATGCCTTTCACAGGCAGG - Intergenic
1133876541 16:9740279-9740301 GGTTTATTCCTTTCAAAGGCGGG - Intergenic
1139777743 16:69327467-69327489 CGGGATTCCTTTTCAAAGTCTGG + Exonic
1141176178 16:81720767-81720789 GGGGCAGCCCTTCCCAAGGCAGG + Intergenic
1143320652 17:6066664-6066686 GGGGCATCCTTTGCAAAGGCAGG - Intronic
1145271442 17:21406953-21406975 GGGGGATCCCTTTGACAGGTGGG + Intronic
1145309645 17:21694357-21694379 GGGGGATCCCTTTGACAGGTGGG + Intronic
1150653911 17:67027252-67027274 GGAGGAGCCGTTTCAAAGGCAGG + Intronic
1153666103 18:7368859-7368881 GGGGAGTCACATTCAAAGGCAGG + Intergenic
1153741987 18:8138725-8138747 AGGGAAGCCCTTGCAGAGGCGGG - Intronic
1155108879 18:22694373-22694395 TCGGGATCACTTTCAAAGGCAGG - Intergenic
1157298390 18:46462191-46462213 GGGAAGTCACTGTCAAAGGCTGG + Exonic
1160842847 19:1154239-1154261 GGGTAATCCCTGTCCATGGCGGG + Exonic
1161819096 19:6518150-6518172 TGGGATTCCCTTTCCAAAGCGGG + Intergenic
1164578997 19:29422817-29422839 GGGGGGTCCCTTACCAAGGCTGG - Intergenic
1165857750 19:38890040-38890062 GGGGAGTCCCTCCCAAGGGCTGG - Intronic
1167804006 19:51766594-51766616 GGGGAATCCCTTTCAAAGGCAGG + Intronic
1168718491 19:58542247-58542269 GGGGAATCCCTGTCTGAGGAGGG - Intergenic
925889868 2:8424992-8425014 TGAGAATGGCTTTCAAAGGCTGG + Intergenic
926049045 2:9731237-9731259 GGGGAAACCCTTGAAAAAGCAGG + Intergenic
928311920 2:30218293-30218315 GGGGAATGCCATTAAAATGCAGG + Intergenic
929225658 2:39509697-39509719 GGGGAATCTTTTTCCAATGCAGG - Intergenic
929489704 2:42385355-42385377 GAGGGAGCCCTTCCAAAGGCAGG + Intronic
932788117 2:74626119-74626141 GGGGACTCCCTTCCCGAGGCTGG - Intronic
937224433 2:120360114-120360136 GTGGAAGACCTTTCACAGGCTGG + Intergenic
938651568 2:133388944-133388966 GGGAATTCCCTTTCATAGCCAGG - Intronic
942329311 2:174805472-174805494 CCGGAATCCCTTTTAAAGGGAGG - Intronic
948171319 2:235905985-235906007 GTGGAATCCCTTTCGGGGGCTGG + Intronic
1169034294 20:2436889-2436911 GGTGAATCGCTAACAAAGGCAGG - Intergenic
1169836008 20:9879977-9879999 GGTGAAACCCTATCAGAGGCTGG - Intergenic
1170121464 20:12916987-12917009 GGGTCATCTCTTTCAAAGGCAGG + Intergenic
1170942035 20:20856080-20856102 GGGGAGTCACTTTCAAGGTCAGG - Intergenic
1177622248 21:23611412-23611434 GGGGAATCCCTTGAACAGGGAGG + Intergenic
1178913997 21:36697122-36697144 GGGTAATCCCTTTCAAGCCCAGG + Intergenic
1183012622 22:34959476-34959498 TGGGAAGCCCTTTCAATGGCAGG - Intergenic
1183416610 22:37686263-37686285 GGGAGGTCCCTTTAAAAGGCTGG + Intronic
1183604948 22:38862817-38862839 GGAAAAGCCCTTTAAAAGGCAGG - Exonic
949309758 3:2683927-2683949 GGGGAATTTCTTTAAAAGGCTGG - Intronic
950560100 3:13716190-13716212 GTGACATCCCTTTCAAAGGGAGG + Intergenic
955961419 3:64344963-64344985 GGTGAGTCACTTCCAAAGGCAGG + Intronic
960517275 3:118616269-118616291 GGAGAATCCCCTTCTAAGTCCGG + Intergenic
964427020 3:156564436-156564458 GGTGAAACCCTTGCAAAGGGTGG - Intergenic
965894000 3:173551668-173551690 GTGAAATTTCTTTCAAAGGCAGG + Intronic
969779475 4:9387307-9387329 GAGAAATCCCTTTCAATGTCCGG + Intronic
969860792 4:10033932-10033954 GGGGAAGCCCTTGAAAAGGGCGG - Intronic
970039096 4:11775951-11775973 GGGGAAACCCTCTCAAAGAAGGG - Intergenic
970172278 4:13301815-13301837 TGGGAAGCCCTTTGAGAGGCAGG + Intergenic
970342595 4:15122109-15122131 AGGGCATCACTTTCAGAGGCTGG - Intergenic
973706257 4:53583759-53583781 AGGGAATGCCTTTCATAAGCAGG + Intronic
973863584 4:55089775-55089797 GGGCCATCCATTTCAAAGGGAGG + Exonic
985629784 5:1008535-1008557 GGGTCCTCCCTTTCAAAGGGAGG + Intergenic
987583073 5:19820677-19820699 GGGGAACCCCTTCCAAATACTGG - Intronic
995644743 5:114298873-114298895 GGGGAATCTCTGTAACAGGCTGG + Intergenic
997161945 5:131618154-131618176 GTGGAAGCCCTTTCAAAGTCAGG - Intronic
998186149 5:139981469-139981491 AGGGAATGCCTTCCAGAGGCAGG - Intronic
999732727 5:154486992-154487014 GGGGAATATGTTTCAAATGCAGG + Intergenic
1003769623 6:9284723-9284745 GGGGCATTCCTTTCAAAAACAGG + Intergenic
1005073453 6:21884241-21884263 AGGGACTCCCTTGCAAAGGGAGG + Intergenic
1006101862 6:31690488-31690510 GGACATTCCCTTTCAAAGGGCGG + Intronic
1008394651 6:50992574-50992596 GGGGAATGCCTATCACAGGGAGG + Intergenic
1014383934 6:120778881-120778903 GGGGAGTCTCTTTCAATTGCTGG + Intergenic
1017015362 6:150095408-150095430 GCAGAATCAATTTCAAAGGCAGG + Intergenic
1018402724 6:163441744-163441766 GGGGAAAAGCTTTCCAAGGCAGG + Intronic
1019117255 6:169774997-169775019 GGGGCCTCCCTCTCAATGGCAGG + Intronic
1019642007 7:2108498-2108520 GGGCATTAACTTTCAAAGGCTGG + Intronic
1024113166 7:46167249-46167271 GTGAAATCCATTTCAAAGGTAGG + Intergenic
1026223729 7:68422738-68422760 GGGGAAGGCCCTTAAAAGGCAGG + Intergenic
1027306664 7:76905623-76905645 GGAAATTCCCTTCCAAAGGCAGG - Intergenic
1028681143 7:93533655-93533677 GGGGAAGCACTCTGAAAGGCTGG + Intronic
1030921268 7:115391640-115391662 AGGGAAGACCTTTCAAAGGTAGG - Intergenic
1035171076 7:157017839-157017861 GGGAAATTCCATTGAAAGGCTGG + Intergenic
1036839762 8:12109846-12109868 GAGAAATCCCTTTCAATGTCCGG - Intronic
1036861553 8:12356086-12356108 GAGAAATCCCTTTCAATGTCCGG - Intergenic
1040874905 8:52141292-52141314 AGGGAATGCATTTCAAATGCTGG - Intronic
1043760927 8:84067238-84067260 GGGGAATACCTTTACAAGACAGG - Intergenic
1047224114 8:122942457-122942479 GTGGCATCCCTGTCAAAGCCCGG + Intronic
1053296424 9:36917451-36917473 GGGGATTCCCTTACAAAAACTGG - Intronic
1053511412 9:38690988-38691010 GGGGAATCAGTTTCCAAGTCTGG + Intergenic
1056428923 9:86507329-86507351 GGGGCTTATCTTTCAAAGGCAGG + Intergenic
1061813172 9:133175430-133175452 GGGGAAGCTATTTGAAAGGCAGG + Intergenic
1189910484 X:45805979-45806001 GAGGGATCCCTTTGGAAGGCAGG - Intergenic
1200702209 Y:6411952-6411974 GGGGTTGCTCTTTCAAAGGCAGG - Intergenic
1200878220 Y:8182375-8182397 GGGCTATGCCTTTCAAAGGAGGG - Intergenic
1201031902 Y:9752746-9752768 GGGGTTGCTCTTTCAAAGGCAGG + Intergenic