ID: 1167805292

View in Genome Browser
Species Human (GRCh38)
Location 19:51779014-51779036
Sequence TGGTAACACAGCCATTGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 160}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167805286_1167805292 8 Left 1167805286 19:51778983-51779005 CCATAGAACAAATGGTCTTTTTT 0: 1
1: 0
2: 3
3: 19
4: 438
Right 1167805292 19:51779014-51779036 TGGTAACACAGCCATTGGGAGGG 0: 1
1: 0
2: 1
3: 16
4: 160
1167805285_1167805292 13 Left 1167805285 19:51778978-51779000 CCACACCATAGAACAAATGGTCT 0: 1
1: 0
2: 0
3: 10
4: 147
Right 1167805292 19:51779014-51779036 TGGTAACACAGCCATTGGGAGGG 0: 1
1: 0
2: 1
3: 16
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167805292 Original CRISPR TGGTAACACAGCCATTGGGA GGG Intronic
902057315 1:13612311-13612333 TGATCACAGTGCCATTGGGAGGG + Intronic
903758934 1:25684366-25684388 TGGTAACACAGCCAAGGGCTTGG - Intronic
904206153 1:28856611-28856633 TGGTGACACTGCATTTGGGAAGG + Intronic
904852468 1:33469117-33469139 TGGGAACACAGGCTTTGGGAAGG + Intergenic
905249918 1:36641533-36641555 TGGTTACACAGCCAATTAGAGGG + Intergenic
905930656 1:41784650-41784672 TGGTTACACACCCCATGGGACGG + Intronic
907386610 1:54129588-54129610 TGGTCACACAGCCTATGGGGAGG + Intergenic
908391499 1:63687515-63687537 TGGTTACACAGCCATTGAAGGGG - Intergenic
910564756 1:88630981-88631003 TGGTAAAACAGCAATAGAGATGG + Intergenic
911871760 1:103108270-103108292 TTGCTACACAGCCATTGGGGAGG + Exonic
912520060 1:110239113-110239135 TGGGAACCCAGCCATTGACAGGG - Intronic
913409703 1:118537560-118537582 TGGTCACAAAGCAATTGTGAGGG - Intergenic
917923401 1:179769586-179769608 AAGTAACACAGCCATTGGGCAGG + Intronic
918016069 1:180633123-180633145 TGTTAGCACAGAAATTGGGAGGG - Intronic
919251616 1:195063811-195063833 TGTTTACACAGCCATTAGAATGG - Intergenic
920513802 1:206569323-206569345 TGGCAACACAGGTTTTGGGAGGG + Intronic
921901454 1:220455770-220455792 TGGCTTCACAGCCACTGGGAGGG + Intergenic
1066366936 10:34786258-34786280 TGGAAACTCTGACATTGGGATGG - Intronic
1066678650 10:37914807-37914829 TGGAAACACAGCAATGGGGCCGG - Intergenic
1073357707 10:102870122-102870144 TGGTGACACAGCCGTTGGTCTGG - Exonic
1078038992 11:7839896-7839918 AGGGAACACAGTCACTGGGATGG + Intergenic
1083602593 11:63958177-63958199 AGGCAGCACAGCCCTTGGGAAGG + Intergenic
1084345149 11:68542091-68542113 AGGAAACACAGCCAGTGTGAGGG + Intronic
1086541311 11:87915818-87915840 TGGTAACAAAGCCATGAGGTGGG + Intergenic
1086556805 11:88120524-88120546 TGGTGTAACAGTCATTGGGAAGG + Intronic
1087795277 11:102449996-102450018 TGGTAATGCAACAATTGGGAAGG - Intronic
1088486766 11:110348287-110348309 TGTAATCCCAGCCATTGGGAGGG - Intergenic
1102397791 12:112602184-112602206 TTGCAACTCAGCCATTGGGAGGG + Intronic
1102870223 12:116408411-116408433 AGGTCACACAGCCAGTGGGATGG - Intergenic
1104179727 12:126367404-126367426 TCGTGAAACAGACATTGGGATGG + Intergenic
1104916512 12:132267621-132267643 TAGTACCACAGCCATTGGCAGGG + Intronic
1108284763 13:48895952-48895974 TGGAGACACAGCTATTGGGGAGG + Intergenic
1109867522 13:68284926-68284948 TACTCACACAGTCATTGGGATGG + Intergenic
1112020501 13:95367147-95367169 TGGTAACATAGGCAGTGGGCAGG - Intergenic
1113237333 13:108293898-108293920 TGGTAGCACAGCCTTCAGGATGG - Intronic
1117988414 14:61410876-61410898 AGGCAACACAGCCATTCGCACGG - Intronic
1120357655 14:83454939-83454961 TGGTAAAACAGAATTTGGGAAGG + Intergenic
1120936483 14:89900592-89900614 CCGGAACACAGCCAGTGGGAAGG + Intronic
1121246130 14:92462085-92462107 GAGTCACACAGCCATTGGGTAGG + Intronic
1121728997 14:96173395-96173417 TGGGGACACAGCCATATGGATGG + Intergenic
1122548538 14:102538159-102538181 GGGTAACTCAGCCACAGGGAAGG + Intergenic
1126406481 15:48328217-48328239 TGGAAACACAGCCAGTAGCAAGG + Intergenic
1127712190 15:61610503-61610525 TCTTAACAAAGCCATTTGGAGGG + Intergenic
1128385921 15:67148278-67148300 CGGTAGCACAGCCAGAGGGAGGG + Intronic
1129906077 15:79188192-79188214 TGGTGGCACAGCTACTGGGAAGG - Intergenic
1129983398 15:79895351-79895373 TGGAAACATAGCCTTGGGGAGGG - Intronic
1130273518 15:82464653-82464675 TGGTCCCACATCCATTGAGAAGG - Intergenic
1130465870 15:84192024-84192046 TGGTCCCACATCCATTGAGAAGG - Intergenic
1130498395 15:84481512-84481534 TGGTCCCACATCCATTGAGAAGG + Intergenic
1130588158 15:85196620-85196642 TGGTCCCACATCCATTGAGAAGG - Intergenic
1134238353 16:12485581-12485603 TGGAAACACAGCCCTCGAGACGG + Intronic
1134467066 16:14488710-14488732 TGATAATACAACTATTGGGAAGG + Intronic
1136751403 16:32638468-32638490 TGGAAAAACAGGAATTGGGAAGG + Intergenic
1138081956 16:54099245-54099267 TAGTGACTCAGCCATTGGGAGGG - Intronic
1139279380 16:65756979-65757001 TGGTTACACACCCATTTGGCAGG + Intergenic
1203053537 16_KI270728v1_random:897723-897745 TGGAAAAACAGGAATTGGGAAGG + Intergenic
1143225700 17:5300836-5300858 TGCTTACAGAGTCATTGGGAGGG + Intronic
1145350889 17:22082058-22082080 TGGTACAACAACCATTTGGAAGG + Intergenic
1149444864 17:56705576-56705598 TGTTAACACATCCAAGGGGAGGG + Intergenic
1153181726 18:2442659-2442681 TGGAAACCCAGACAGTGGGAGGG - Intergenic
1157364737 18:47054370-47054392 TGACAAAACAGACATTGGGAGGG - Intronic
1158838846 18:61361206-61361228 TGGTAACAGAGCTAGGGGGAAGG + Intronic
1159914317 18:74175018-74175040 TGGTAACACAGAAATGGGGGTGG + Intergenic
1161643091 19:5436412-5436434 TGATAAAAGAGCCCTTGGGAGGG + Intergenic
1162590233 19:11586612-11586634 TGGTGAAACAGGCATTGGGGGGG + Intronic
1166356815 19:42232213-42232235 TGGGAACCCAGCTATTGGGAAGG + Intronic
1166431144 19:42729156-42729178 TCGTAACTCAGCCACTGGCATGG - Exonic
1166434268 19:42754366-42754388 TCGTAACTCAGCCACTGGCAAGG - Exonic
1166444151 19:42844392-42844414 TCGTAACTCAGCCACTGGCAAGG - Intronic
1166447118 19:42868134-42868156 TCGTAACTCAGCCACTGGCAAGG - Exonic
1166451589 19:42906955-42906977 TCGTAACTCAGCCACTGGCAAGG - Exonic
1166454042 19:42925806-42925828 TCGTAACTCAGCCACTGGCAAGG - Exonic
1166483590 19:43194373-43194395 TCGTAACTCAGCCACTGGCAAGG - Exonic
1166638490 19:44473289-44473311 GGCTAACTCAGCCTTTGGGAGGG + Intergenic
1167805292 19:51779014-51779036 TGGTAACACAGCCATTGGGAGGG + Intronic
1168629671 19:57947210-57947232 AGGTGACACAGCCATTGCGAGGG - Intronic
925752093 2:7097794-7097816 AGGCATCACAGCCAGTGGGAGGG + Intergenic
925765085 2:7225436-7225458 TGGTAACAGTGCCATTAGCATGG - Intergenic
928620021 2:33079324-33079346 TGGGAACACACACATGGGGATGG + Intronic
935042799 2:99449609-99449631 TGGCAACACAGCCAAGGAGAAGG - Intronic
935316007 2:101834426-101834448 TGGCATTACAGCCATTGAGATGG + Exonic
937607630 2:123820469-123820491 TGGTAACACAAGCTGTGGGAGGG - Intergenic
937890853 2:126937427-126937449 AGGTAGCACAGCCTTTGGGAAGG - Intergenic
938574636 2:132592540-132592562 TGGATGCAGAGCCATTGGGAGGG + Intronic
939042656 2:137209215-137209237 TTATAACACAGGCATTGGAAAGG - Intronic
939660352 2:144881434-144881456 TGGAGACACAGCCTTTGGGGAGG - Intergenic
939737249 2:145862956-145862978 TGGTATTAAAGCCATTGGGTTGG - Intergenic
941166621 2:162089892-162089914 TGGTAACACAGCTGTAGGGGTGG - Intergenic
948829543 2:240591584-240591606 TCCTAAAACAGCCCTTGGGATGG - Intronic
1168978223 20:1983757-1983779 TGTGAACACACCCATTGGGTGGG + Intronic
1169010209 20:2244198-2244220 TGGGAACACAGACTTGGGGAGGG - Intergenic
1170750455 20:19140355-19140377 TGGTACCACAGAGAGTGGGATGG - Intergenic
1172127625 20:32634291-32634313 TAGCAAGACAGGCATTGGGAGGG + Intergenic
1172455587 20:35070005-35070027 TGAGAACACAGCCAATGGGGAGG + Intronic
1173022924 20:39283085-39283107 AGGTGACACAGCCCTTGGCAAGG + Intergenic
1178463195 21:32821872-32821894 TGGTACCGCAGCCATTTGGGAGG + Intergenic
1179254852 21:39706755-39706777 TGGTCTCCCAGCCCTTGGGAGGG + Intergenic
1180606809 22:17065153-17065175 TGGTATTCCAGCCAGTGGGAAGG - Intergenic
1182772795 22:32807830-32807852 TGTTAACACAGCCACTGTGGAGG - Intronic
1184660699 22:45964317-45964339 TGGTAGCACTGCCCTGGGGATGG - Intronic
951355355 3:21660444-21660466 TGGAAATAGAGCCATGGGGACGG + Intronic
952236508 3:31486075-31486097 GGGTGACACAGCCACAGGGATGG - Intergenic
952323726 3:32301564-32301586 GGGAGACACAGCCCTTGGGAGGG + Intronic
952906725 3:38143904-38143926 TGGGAACACAGCTAATGGGAAGG - Intergenic
953766370 3:45746694-45746716 TGGGGACACAGCCAGTGGCACGG + Intergenic
954792930 3:53146281-53146303 GGGTACCAGAGCCCTTGGGAGGG - Intergenic
955032068 3:55231574-55231596 TGGAAACAGAGCAATGGGGATGG - Intergenic
955690426 3:61585411-61585433 TGGTACTATAGCCATTGGGTGGG + Intronic
960312523 3:116133863-116133885 TGGGAATACACCAATTGGGAAGG - Intronic
960700616 3:120435830-120435852 CGGAAACACAGCCACTGGGGAGG + Intronic
961467637 3:127091257-127091279 AGGTGACACAGCCAGTGGGGTGG - Intergenic
963808478 3:149750987-149751009 TGGTAACACAGATTTTGGAATGG - Intronic
965760751 3:172073507-172073529 TGGCAAAACAACCTTTGGGAGGG + Intronic
966093303 3:176166938-176166960 TGGTAACACAGTGATTGGGATGG + Intergenic
966252148 3:177877948-177877970 TGGTTACACAGCTAATGAGAGGG + Intergenic
968505822 4:971108-971130 GGGTAGGACAGCCATTGGGTAGG - Intronic
970093773 4:12438914-12438936 TGGTAAAAAAGACAGTGGGAGGG + Intergenic
971119909 4:23691786-23691808 TGTTAATACAGCCATTTTGAAGG + Intergenic
976224924 4:82788337-82788359 TGGTAAACCAGTCATTGGGAAGG - Intronic
978104592 4:104886286-104886308 TGGAAACACAGACACTAGGAAGG - Intergenic
979106073 4:116688130-116688152 TAGTGACACAGCCAGTGGGGAGG - Intergenic
985518852 5:361276-361298 TGGTGAAACAGCCATTGGATAGG + Intronic
985532515 5:442564-442586 TGGGAACAATGCCAGTGGGATGG - Exonic
985685896 5:1281310-1281332 AGGTAACACAGCCTCTGGGCTGG - Intronic
989704936 5:44318262-44318284 TGGTAACAAAGCCATGAGCAAGG + Intronic
990171817 5:53059676-53059698 AAATAACACAGCCAATGGGAAGG + Intronic
992208100 5:74450861-74450883 TAGTGTCACAGCCTTTGGGAAGG - Intergenic
993315251 5:86395894-86395916 TGCTCGCATAGCCATTGGGATGG + Intergenic
993792147 5:92222011-92222033 AGGTGACACAGTCATTTGGAGGG + Intergenic
995215998 5:109594947-109594969 TAGAAACACAGACATTGGGAAGG - Intergenic
995748252 5:115426573-115426595 TGATAATACAGGCACTGGGATGG - Intergenic
997197582 5:131990104-131990126 TGGTAGGACAGCCACTGGTAAGG + Exonic
997402850 5:133615963-133615985 TGGTAACAATGCCATGGTGAGGG - Intergenic
997427485 5:133813761-133813783 TGGTAGCAATGCCATGGGGATGG - Intergenic
998500412 5:142627699-142627721 TGGTATCACAGCCAAAGGGCAGG + Intronic
998566411 5:143219916-143219938 AGATAACACAGCCTTTGGGTTGG - Intronic
998608290 5:143659837-143659859 TGTTTACAGATCCATTGGGAGGG + Intergenic
999546389 5:152633144-152633166 GGGTAGCACAGCCATTAGGAGGG + Intergenic
1001404207 5:171464143-171464165 AGGAAACACAGCCAGTGAGAGGG - Intergenic
1001419890 5:171578490-171578512 TGGAAACCCAGCCATGGGAAAGG + Intergenic
1001582341 5:172807379-172807401 TGGTGACGCAGCTAATGGGAGGG - Intergenic
1001667541 5:173445741-173445763 GGGTAACACAGGCATAGTGATGG + Intergenic
1003020040 6:2502031-2502053 TAGTACCCCAGCCATGGGGAGGG + Intergenic
1003946943 6:11084596-11084618 TGCTAAAACAGCAGTTGGGAAGG - Intergenic
1004593237 6:17073812-17073834 TGTAAACAAAGCCACTGGGAAGG + Intergenic
1005140151 6:22622681-22622703 TGGTAATACAGCAATGGGGGTGG + Intergenic
1007926351 6:45652572-45652594 TAGGAACACACCCATTTGGAAGG - Intronic
1020836788 7:13163577-13163599 TGGTCAAAGAGCCATTGGCAAGG + Intergenic
1026177654 7:68012199-68012221 TAGTAACACAGCCCTAGGGAAGG + Intergenic
1028429944 7:90735599-90735621 TGTAAACAAAGCCATCGGGAAGG - Intronic
1029219787 7:98979005-98979027 TGGAAAGACAGCTTTTGGGAAGG + Intronic
1029638648 7:101803821-101803843 TTTGAACACAGCCATAGGGATGG + Intergenic
1031965173 7:128022708-128022730 TATTAACACAGTCATGGGGAGGG - Intronic
1033422996 7:141219167-141219189 AGGTAACCGAGCCAGTGGGAGGG + Intronic
1033664389 7:143426857-143426879 TGGTAAGACAGCCCTTTGGTGGG + Intergenic
1034137480 7:148784242-148784264 TTGAAAAACAGCCAGTGGGAGGG - Intronic
1035376768 7:158411574-158411596 AGGTAACACAGCCAGTCAGAGGG + Intronic
1037287867 8:17320421-17320443 TGGCAACAAGGCAATTGGGAAGG + Intronic
1037329752 8:17732683-17732705 TGGAAACACAGATGTTGGGAAGG - Intronic
1039455522 8:37703391-37703413 TGTTATTACAGCCATTGGGGAGG - Intergenic
1041195707 8:55399679-55399701 TGCCAATGCAGCCATTGGGAGGG + Intronic
1042627145 8:70770687-70770709 TGTAAACAAAGCCACTGGGAAGG - Intronic
1045246471 8:100445633-100445655 TGTTAACTCAGCCATTGTTAAGG - Intergenic
1045438622 8:102188666-102188688 GAGTAACACAGCCTTAGGGATGG + Intergenic
1045545700 8:103126299-103126321 TGGTAATACATCTATTGTGAGGG + Intergenic
1049505204 8:142992464-142992486 TGGGCACACAGCCAATTGGAGGG - Intergenic
1050161157 9:2719438-2719460 TGGCATCACAGCCTTTGAGATGG + Intronic
1050280865 9:4048734-4048756 TGGAAAGACAGCCCTTGAGAGGG - Intronic
1050792928 9:9496524-9496546 TGGTAACACACCCATAAGGATGG + Intronic
1053466176 9:38310326-38310348 TGCTTACCCAGTCATTGGGAGGG - Intergenic
1056765426 9:89441946-89441968 TGTAAACACAGCCATGGGGATGG - Intronic
1056891163 9:90494232-90494254 TGGGAACACCGGCACTGGGAGGG + Intergenic
1061313127 9:129777076-129777098 TGGCAGAACAGCCATTGGAATGG + Intergenic
1061404325 9:130385182-130385204 TGGGCTCACAGCCATGGGGAAGG + Intronic
1187992256 X:24887603-24887625 TAGTCACTCAGCTATTGGGAAGG + Intronic
1195981127 X:110579692-110579714 TGGTAAAACAGCAATAGGGGAGG + Intergenic
1197881937 X:131176038-131176060 TGGTAACACTGCCATTCTCAAGG + Intergenic
1200826761 Y:7652985-7653007 TGGAATCACAGCCCTTTGGAAGG - Intergenic