ID: 1167806807

View in Genome Browser
Species Human (GRCh38)
Location 19:51792621-51792643
Sequence CAAGTTGCTCATATTGGCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 145}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167806807_1167806810 12 Left 1167806807 19:51792621-51792643 CCTAAGCCAATATGAGCAACTTG 0: 1
1: 0
2: 2
3: 7
4: 145
Right 1167806810 19:51792656-51792678 TTTTTTTTTTTTTTGAGGTAAGG 0: 69
1: 2466
2: 19491
3: 29721
4: 158777
1167806807_1167806811 30 Left 1167806807 19:51792621-51792643 CCTAAGCCAATATGAGCAACTTG 0: 1
1: 0
2: 2
3: 7
4: 145
Right 1167806811 19:51792674-51792696 TAAGGTATTGCTCATTGCCCAGG 0: 1
1: 0
2: 1
3: 31
4: 202
1167806807_1167806809 7 Left 1167806807 19:51792621-51792643 CCTAAGCCAATATGAGCAACTTG 0: 1
1: 0
2: 2
3: 7
4: 145
Right 1167806809 19:51792651-51792673 TTTTTTTTTTTTTTTTTTTGAGG 0: 5644
1: 19016
2: 22217
3: 49735
4: 178307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167806807 Original CRISPR CAAGTTGCTCATATTGGCTT AGG (reversed) Intronic
907915230 1:58862121-58862143 TAATTTTTTCATATTGGCTTTGG + Intergenic
911717524 1:101151131-101151153 TAGGTTGGTCATATTCGCTTTGG + Intergenic
915069783 1:153257237-153257259 CAAATTGTCCATGTTGGCTTTGG - Intergenic
919206186 1:194423781-194423803 CAAATTGGTCCTAATGGCTTAGG - Intergenic
919554933 1:199039503-199039525 CAAGATACTCATATTACCTTCGG - Intergenic
919721491 1:200841675-200841697 TAAGTTGCTTATATTTACTTTGG + Intronic
1063513292 10:6668532-6668554 AAAGGTGCTGGTATTGGCTTGGG + Intergenic
1068504317 10:57880402-57880424 CAAGTTTGTCATATTAGCTTGGG + Intergenic
1074742745 10:116500644-116500666 CAAATTGGTCCTAATGGCTTAGG - Intergenic
1075625052 10:123957840-123957862 CAATATGCTAAAATTGGCTTAGG - Intergenic
1076095041 10:127726392-127726414 CCATTTGTTCATATTTGCTTTGG - Intergenic
1076228523 10:128800536-128800558 CATCTTGCTCTTATTGGCTTTGG + Intergenic
1077855838 11:6123583-6123605 ACAGTAGCTCATAGTGGCTTAGG + Intergenic
1078805907 11:14703126-14703148 CAAATTGCTCATATTTTTTTGGG + Intronic
1082899566 11:58231650-58231672 CAAGTTGCTAATAATTGCTGTGG + Intergenic
1083072071 11:59994914-59994936 AATGTTGCTCAGATTTGCTTGGG + Intergenic
1086270424 11:85057377-85057399 AAAGTTGTTTATATTGTCTTTGG - Intronic
1087074912 11:94119954-94119976 CAAATTGCTCCCAATGGCTTAGG - Intergenic
1093422626 12:18992472-18992494 CAGGTTGGTAATATTGGGTTAGG - Intergenic
1095848791 12:46777710-46777732 GAAGTTGTTGATATTTGCTTGGG - Intronic
1101133604 12:101715285-101715307 TCATTTGCTCATTTTGGCTTTGG + Intronic
1103167306 12:118781178-118781200 CAAGTTGACAAGATTGGCTTTGG - Intergenic
1103199748 12:119078080-119078102 CAAGCTGCTTATGTTGTCTTTGG - Intronic
1107334266 13:39336802-39336824 CAAGTTGCACTTATTTGATTTGG - Intergenic
1107510854 13:41082587-41082609 GAAGTTGCTCATTTTGGAGTAGG - Intronic
1108685144 13:52813083-52813105 CAATTTGCTCAAGTTGGTTTAGG + Intergenic
1111108785 13:83680176-83680198 CAAATTGCTTGTTTTGGCTTTGG + Intergenic
1111258169 13:85699615-85699637 CAGGTTGCTGCTACTGGCTTGGG + Intergenic
1112718531 13:102214905-102214927 TAAGTTGCTCATATTTGGTATGG + Intronic
1114346658 14:21803364-21803386 CAAAATGCTCATATAGCCTTGGG - Intergenic
1115000753 14:28417567-28417589 CCAGTTACTGATATTGGGTTAGG - Intergenic
1119567108 14:75638036-75638058 AAGGTTTCTCACATTGGCTTTGG + Intronic
1124891817 15:33740736-33740758 CAAGGGGCTCATATAGGCTCAGG - Intronic
1126736197 15:51734311-51734333 CATGTTCCTCAAATTGGCCTGGG - Intronic
1127587910 15:60396139-60396161 TATGTTGCTCACATTGGCCTTGG + Intronic
1129122622 15:73410554-73410576 CCAGTTCTTCATAATGGCTTCGG - Intergenic
1130104998 15:80922368-80922390 CAACTTGCTCCTTTTGGCTCTGG - Intronic
1131880287 15:96855032-96855054 CAATTTTATCACATTGGCTTAGG - Intergenic
1135879879 16:26244696-26244718 CAATTTGTTCATTTTTGCTTTGG - Intergenic
1137543341 16:49379525-49379547 CAATTTGGTCACAATGGCTTTGG - Intronic
1142703065 17:1676229-1676251 CAAGTTGCTCATCTTGGCATTGG - Exonic
1144087522 17:11824035-11824057 CAATTTGCTCATCTTCCCTTGGG + Intronic
1150048714 17:61937963-61937985 AAAGTTGCTCATTTTCACTTTGG + Intergenic
1154038450 18:10830658-10830680 CCATTTGCTCATTTTTGCTTTGG - Intronic
1154152933 18:11921110-11921132 CAACTTTCTCATTTTGGGTTTGG - Intergenic
1155116310 18:22771604-22771626 CAATTTGTTCATTTTTGCTTTGG - Intergenic
1155563697 18:27109414-27109436 GAAGTCGCTCATTTTCGCTTTGG + Intronic
1155791919 18:29982983-29983005 CAGGTTTCTCATATTGGCCTGGG - Intergenic
1156331558 18:36128906-36128928 TAAGGTGCTCAGATGGGCTTCGG - Intronic
1167806807 19:51792621-51792643 CAAGTTGCTCATATTGGCTTAGG - Intronic
1167808635 19:51809034-51809056 CCAGTTACTGATATTGGGTTAGG + Intronic
1167882854 19:52476496-52476518 CCAGTTTCTCATATCGGGTTAGG + Intronic
927533056 2:23827961-23827983 TAAGTTGTTCTTTTTGGCTTTGG + Intronic
929264072 2:39899039-39899061 CAAGCTTCTCATCATGGCTTTGG + Intergenic
929330274 2:40673923-40673945 CAAATTGGTCACAATGGCTTAGG - Intergenic
930149480 2:48044060-48044082 CCAGTTGGTTATATTGGATTAGG + Intergenic
930263789 2:49176565-49176587 CAAGTTTCTCACATTTGGTTAGG + Intergenic
930944447 2:57056024-57056046 CAATTTGCCCATTTTTGCTTTGG + Intergenic
935698818 2:105792800-105792822 CAGGTTGCTCACATGGGCCTCGG - Intronic
937009884 2:118552919-118552941 CTTGTTACTCATTTTGGCTTGGG + Intergenic
937111731 2:119371863-119371885 CTCGTGGCTGATATTGGCTTTGG - Intronic
938652629 2:133399512-133399534 CAAAATGCTCAAGTTGGCTTTGG - Intronic
938814637 2:134888055-134888077 CATGTTGCTAATGTTGTCTTAGG - Intronic
939723058 2:145679137-145679159 ATAGTTGCTCTTATTGGCTACGG - Intergenic
940047158 2:149421938-149421960 CAAGATGCTGATCTTAGCTTGGG + Intronic
941243313 2:163068520-163068542 CAAATTGGTCCTAATGGCTTAGG - Intergenic
944703963 2:202270432-202270454 TAACTTGCTCATATTGTCTGTGG + Intronic
944736388 2:202570549-202570571 CAAGTTGCTCACAGTAGATTTGG + Intergenic
947364472 2:229380100-229380122 CAAGTTGATCAAATTGACGTTGG + Intronic
1171359640 20:24577999-24578021 AGTGTTGTTCATATTGGCTTAGG + Intronic
1173742291 20:45409469-45409491 CAAGTTAAGCATATGGGCTTTGG - Intronic
1181942458 22:26489028-26489050 GGATTTGCTCATACTGGCTTTGG - Intronic
1182386529 22:29947248-29947270 TAAGTAGCTCAGATTGACTTTGG + Intronic
1183865279 22:40699445-40699467 GAAGGTGCACATATTGTCTTGGG + Intergenic
951011027 3:17679960-17679982 GAAGTTTCACATATTGGTTTGGG - Intronic
953101249 3:39830520-39830542 AAAGTTCCTCACAATGGCTTTGG - Intronic
955058955 3:55480834-55480856 CAAGTTCTTCCTAGTGGCTTTGG - Exonic
956183773 3:66543755-66543777 CAAGTAGCTCATATTGTGTCTGG + Intergenic
959873256 3:111352322-111352344 CAATTTGATCATATTTGCATGGG + Intronic
963745184 3:149118469-149118491 CAAGTTGCTCAGTCTGGCTTTGG + Intergenic
967165163 3:186773551-186773573 CAAGTAGATTATATTGGCCTTGG - Intergenic
968807712 4:2786526-2786548 CAAGTAGCTCAGAATGGCTCTGG - Intergenic
975144927 4:70956628-70956650 CATGTTGCCCAGATTGGCCTGGG + Intronic
975375618 4:73640925-73640947 CCATTTGTTCATATTTGCTTTGG + Intergenic
975828807 4:78347678-78347700 CAAGTTCCTCTTATTCACTTTGG + Intronic
976446554 4:85136552-85136574 GCAGTTCCTCATAGTGGCTTTGG + Intergenic
978211454 4:106142263-106142285 TAAGTTGCTCATTTTTGGTTTGG + Intronic
981257589 4:142680771-142680793 CAAGCATCTCATTTTGGCTTTGG + Intronic
986753373 5:10810988-10811010 CAAGTTGCTACTCTTAGCTTTGG + Intergenic
987363845 5:17130705-17130727 CAGGTTGCCCCTGTTGGCTTGGG + Intronic
988592133 5:32558089-32558111 CAAATTGGTCCCATTGGCTTAGG + Intronic
988605610 5:32676209-32676231 CAAATTGGTCCCATTGGCTTAGG + Intergenic
988966517 5:36424004-36424026 CAAGTTTCTCTTATTTCCTTGGG - Intergenic
989432148 5:41368315-41368337 CAAGTAGCTCATAGTGAATTTGG - Intronic
991291000 5:65033986-65034008 CAAGCTGCTGATTGTGGCTTAGG + Intergenic
991594396 5:68288229-68288251 CAACTTGCTCATTTTCGCCTGGG - Intronic
992455080 5:76909272-76909294 CAAATTGGTCCCATTGGCTTAGG - Intronic
992791755 5:80220255-80220277 TAACTTGCTCATATTGGCAGCGG + Intronic
993153906 5:84197285-84197307 CAAGTTTCCAATATTGGATTAGG - Intronic
993272057 5:85809183-85809205 CAAGTTGGTAATCTTGGCTTTGG - Intergenic
996178163 5:120386009-120386031 ACTGTAGCTCATATTGGCTTAGG + Intergenic
998013717 5:138715917-138715939 AAAGCTGCTCCTAGTGGCTTTGG + Intronic
1000378219 5:160603990-160604012 CAAGCTGCTGATATTGGAATTGG - Exonic
1000755062 5:165147902-165147924 CAACTTGCTGTTACTGGCTTTGG + Intergenic
1001753857 5:174151211-174151233 CAAGGTGCTCCTATTGGATGAGG - Intronic
1005196719 6:23295855-23295877 CAGGTTGCTACTATTGGCTCAGG - Intergenic
1006588547 6:35136062-35136084 CATGTTGCTCATCCTGGCTTAGG - Intronic
1007919915 6:45597633-45597655 CAAGTTGCACATATCAGCTCTGG + Intronic
1010775971 6:79886216-79886238 CCATTTGCCCATATTTGCTTTGG - Intergenic
1010839262 6:80628781-80628803 CAATTTGTTCATTTTTGCTTTGG - Intergenic
1013091889 6:106907677-106907699 GAAATTGGTCATATTGGATTTGG - Intergenic
1013974565 6:116062153-116062175 CAAGTTTCTCCAATTGTCTTTGG + Intergenic
1015392308 6:132696530-132696552 CAAGATTCTCATTTTGTCTTTGG - Intronic
1017013276 6:150079542-150079564 CTAGTGGCTCACATGGGCTTTGG - Intergenic
1017386136 6:153885965-153885987 CCAGTTTCTCATATTTGCTAAGG + Intergenic
1017455660 6:154598974-154598996 CAAGGCTCTCATATTGTCTTTGG - Intergenic
1018757197 6:166860522-166860544 CAAGCTGCTCCTCATGGCTTTGG + Intronic
1019086386 6:169481423-169481445 CAGGTTGCTGCTGTTGGCTTGGG - Intronic
1019974165 7:4567340-4567362 CATGCTGCTCATGTTGGCCTTGG - Intergenic
1020736349 7:11953785-11953807 CCAGTTGATCATATTGGATAGGG + Intergenic
1020883740 7:13796691-13796713 CAATTTGCTCATATTAACTAAGG + Intergenic
1024172191 7:46801352-46801374 CAAAATGTTCATATTGTCTTTGG + Intergenic
1024621965 7:51168041-51168063 CCACTTGTTCATATTTGCTTTGG - Intronic
1024901832 7:54327139-54327161 CAAATTGCCCATATTGCTTTTGG - Intergenic
1024959920 7:54963282-54963304 CAGGGTGTTCATATTGTCTTTGG + Intergenic
1028293715 7:89100442-89100464 CAATTTGTTCATTTTTGCTTTGG - Intronic
1028723074 7:94056295-94056317 CAAGCTGAACACATTGGCTTTGG + Intergenic
1028951232 7:96637397-96637419 CACCTTGCTTGTATTGGCTTTGG - Intronic
1030752936 7:113253627-113253649 CCATTTGCTCATTTTTGCTTTGG - Intergenic
1035107270 7:156452316-156452338 CAAGGTGCTTATATTGTATTGGG - Intergenic
1039117426 8:34107650-34107672 GAAGTTGCTAAGATTGGCTTAGG + Intergenic
1039910581 8:41823846-41823868 CAAGTTAATAATATTGGGTTAGG - Intronic
1040028021 8:42799484-42799506 CATGTTGCTCAGATTGGTCTTGG + Intergenic
1045453820 8:102356042-102356064 TATGTTGCTCAAATTGTCTTAGG - Intronic
1047595616 8:126374939-126374961 CGAGTTCCTCTTTTTGGCTTGGG - Intergenic
1048019427 8:130524866-130524888 CAAGTTGCTTATTTTCTCTTAGG + Intergenic
1050715247 9:8517147-8517169 CAAGGTGATCAGTTTGGCTTTGG - Intronic
1056066162 9:82937152-82937174 CAGGTTTTTCATATTGACTTTGG - Intergenic
1056473509 9:86929297-86929319 CCAGTTGTTCATGTTTGCTTTGG - Intergenic
1056860782 9:90179235-90179257 AAGGTTGGTCATAGTGGCTTGGG + Intergenic
1057644631 9:96861220-96861242 CAATTTGCCCATTTTTGCTTTGG - Intronic
1058354601 9:104068996-104069018 CAAGAAGCTCATCTTGTCTTTGG + Intergenic
1058546413 9:106064905-106064927 AAAGTTGCTCATAGTTGCATTGG - Intergenic
1060098140 9:120812392-120812414 CAAGTATCTGATATTTGCTTGGG + Intergenic
1061478331 9:130884065-130884087 CAAGTTGGTCTTTTTGTCTTTGG - Exonic
1186990650 X:15063555-15063577 CAAGCTTCTCATTTTAGCTTAGG + Intergenic
1187704420 X:21995245-21995267 CAAGTTGCTCATATTGCCATAGG - Intergenic
1189059908 X:37742232-37742254 CAATTTGTCCATATTTGCTTTGG - Intronic
1192870153 X:75176976-75176998 CAAATTGGTCCTAATGGCTTAGG + Intergenic
1195108008 X:101618619-101618641 CAAGTTGAACATATTTTCTTCGG + Intergenic
1196234772 X:113266051-113266073 CCATTTGCTCATTTTTGCTTTGG + Intergenic
1198911860 X:141624001-141624023 CAAGCTTCTCATATTGTTTTTGG - Intronic
1199636129 X:149812821-149812843 CAAATTTCTCATATTGCCATGGG + Intergenic
1199985224 X:152945417-152945439 CAAGTTGCTCAGATCCGCTGGGG - Exonic
1200880929 Y:8210612-8210634 CAAATTGATCACAATGGCTTAGG + Intergenic