ID: 1167810843

View in Genome Browser
Species Human (GRCh38)
Location 19:51828883-51828905
Sequence CCTGCCCTCCAGGAGCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167810843_1167810847 -7 Left 1167810843 19:51828883-51828905 CCCTGCAGCTCCTGGAGGGCAGG No data
Right 1167810847 19:51828899-51828921 GGGCAGGTTTCATTGTAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167810843 Original CRISPR CCTGCCCTCCAGGAGCTGCA GGG (reversed) Intergenic
No off target data available for this crispr