ID: 1167810893

View in Genome Browser
Species Human (GRCh38)
Location 19:51829257-51829279
Sequence TAGCCACAGCCCCGACAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167810892_1167810893 3 Left 1167810892 19:51829231-51829253 CCGAGGAGGGAGCTGTAAAGAGT No data
Right 1167810893 19:51829257-51829279 TAGCCACAGCCCCGACAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167810893 Original CRISPR TAGCCACAGCCCCGACAAGC TGG Intergenic
No off target data available for this crispr