ID: 1167812143

View in Genome Browser
Species Human (GRCh38)
Location 19:51842706-51842728
Sequence CATGGTCTGTGAACCTTTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167812143_1167812146 1 Left 1167812143 19:51842706-51842728 CCCTTAAAGGTTCACAGACCATG No data
Right 1167812146 19:51842730-51842752 GAAAATGTATTAAAATAACAAGG No data
1167812143_1167812147 2 Left 1167812143 19:51842706-51842728 CCCTTAAAGGTTCACAGACCATG No data
Right 1167812147 19:51842731-51842753 AAAATGTATTAAAATAACAAGGG No data
1167812143_1167812148 19 Left 1167812143 19:51842706-51842728 CCCTTAAAGGTTCACAGACCATG No data
Right 1167812148 19:51842748-51842770 CAAGGGTGCCAACCCATCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167812143 Original CRISPR CATGGTCTGTGAACCTTTAA GGG (reversed) Intergenic
No off target data available for this crispr