ID: 1167812776

View in Genome Browser
Species Human (GRCh38)
Location 19:51849115-51849137
Sequence CTATTTCCACAGTTTGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167812772_1167812776 30 Left 1167812772 19:51849062-51849084 CCTTTTAAAATATGTGCACATTT No data
Right 1167812776 19:51849115-51849137 CTATTTCCACAGTTTGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167812776 Original CRISPR CTATTTCCACAGTTTGGGGA AGG Intergenic
No off target data available for this crispr