ID: 1167816588

View in Genome Browser
Species Human (GRCh38)
Location 19:51887730-51887752
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 45}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167816588 Original CRISPR TCCGTGTTGCGGGGAGCTCT CGG (reversed) Intronic