ID: 1167816588

View in Genome Browser
Species Human (GRCh38)
Location 19:51887730-51887752
Sequence TCCGTGTTGCGGGGAGCTCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 45}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167816588 Original CRISPR TCCGTGTTGCGGGGAGCTCT CGG (reversed) Intronic
900098195 1:948913-948935 TCTGTGTGGCAGGGACCTCTAGG - Intronic
900549651 1:3247842-3247864 GCCGCGGTGCGGGGACCTCTGGG + Intronic
900555406 1:3277948-3277970 TCCGTGCATCCGGGAGCTCTAGG + Intronic
901526006 1:9823827-9823849 TCCGCGGCGCGGGGAGCTCCGGG + Exonic
908148106 1:61268762-61268784 TCCCTTTTCCTGGGAGCTCTGGG + Intronic
1067068928 10:43118779-43118801 CCCGTGGGGCAGGGAGCTCTAGG + Intronic
1069842020 10:71345852-71345874 GCCGTGGTGGGGGGAGCCCTTGG + Intronic
1069879845 10:71585108-71585130 TCCTTGCCGCGGGGAGGTCTGGG + Intronic
1074960826 10:118444230-118444252 TCCTTATTGTGGGGAGCACTTGG + Intergenic
1075608931 10:123836118-123836140 TCCCCGTTGCGGGGATCTCCAGG - Intronic
1103520945 12:121536902-121536924 TCGGGGTTGCGGGGAGCTGGAGG - Intronic
1112963669 13:105160078-105160100 TCTGTCTTGCGAGGTGCTCTGGG - Intergenic
1123026729 14:105428187-105428209 TCAGTGTTGCTGGGAGCTGGGGG - Intronic
1123880916 15:24676819-24676841 GGCCTGTTGCGGGCAGCTCTGGG - Exonic
1128713106 15:69886671-69886693 TCCCTCATGCTGGGAGCTCTGGG - Intergenic
1132544544 16:527343-527365 TCCGTGTCCCGCGGGGCTCTGGG - Intergenic
1138496984 16:57415014-57415036 TGTGTGTTGCGGGGACCTCTGGG - Intronic
1142009782 16:87707996-87708018 GCCGTGTTGAGTGAAGCTCTTGG - Exonic
1143479168 17:7218794-7218816 TCCTTGTGGAGGGGAGGTCTGGG - Intronic
1144631033 17:16872589-16872611 TCTGTGCTGTGGGGAGCCCTGGG - Intergenic
1144650279 17:17002887-17002909 TCCCTGCTGTGGGGAGCCCTGGG + Intergenic
1147161153 17:38570049-38570071 TGTGTGTTGCGGGGCGCTGTGGG - Intronic
1149561599 17:57611510-57611532 TCCGTGTGGGAGGGGGCTCTAGG - Intronic
1152790414 17:82275613-82275635 TACGTCCTGCCGGGAGCTCTGGG - Intergenic
1154332459 18:13441046-13441068 TCTGTGTGGCTGGGAGCTCCGGG + Intronic
1162572329 19:11480632-11480654 TCCGTGTTGAGGGGGGCTCCGGG + Exonic
1167816588 19:51887730-51887752 TCCGTGTTGCGGGGAGCTCTCGG - Intronic
1168217369 19:54936192-54936214 ACCGTGTTGCTGGGGGATCTAGG - Intronic
948723104 2:239913570-239913592 TCAATACTGCGGGGAGCTCTGGG + Intronic
1177948990 21:27510367-27510389 TCCGTGTAGCCGCGAACTCTTGG - Intergenic
1179575682 21:42306949-42306971 TCTGTGACGCTGGGAGCTCTGGG + Intergenic
1183154559 22:36065371-36065393 TCCAGCTTGCGGGGAGCTTTTGG + Intergenic
1183349820 22:37328837-37328859 TGCAGGTTGCGGGGAGCTGTAGG - Intergenic
1183725981 22:39589982-39590004 TCTGTGATTCGGGGGGCTCTGGG - Intronic
1184397140 22:44249042-44249064 TCTGTGTCTCGGGGAGCACTGGG - Exonic
1185009843 22:48306817-48306839 TCAGGGTTCCAGGGAGCTCTGGG - Intergenic
953890930 3:46751004-46751026 CCAGTTTTGCGGGGAGCTGTCGG - Intronic
957717967 3:83956552-83956574 TCTGTGTTGCTGGGAGACCTAGG + Intergenic
969704221 4:8783270-8783292 TCCGTGCGGCAGGGAGCCCTGGG - Intergenic
1006385898 6:33730754-33730776 TCGGTGTGGGGTGGAGCTCTGGG + Intronic
1017444253 6:154493064-154493086 TCAGTGTTTTGGGGAGCTATTGG - Intronic
1018221257 6:161582053-161582075 TCAGTCATGCGTGGAGCTCTGGG - Intronic
1033735657 7:144218919-144218941 TCCATGGTGGTGGGAGCTCTGGG + Intergenic
1033747395 7:144332050-144332072 TCCATGGTGGTGGGAGCTCTGGG - Intergenic
1034823430 7:154237854-154237876 TCCCTGCTGAGGGGAGCCCTGGG + Intronic
1040601033 8:48883970-48883992 TCTGTCTTGTTGGGAGCTCTGGG + Intergenic
1185837603 X:3359889-3359911 TCAGTGGTGCTGGGAGCTCCTGG - Intergenic
1196339469 X:114581322-114581344 ACCGTGTTCCGGGGGGCACTGGG + Intergenic