ID: 1167820937

View in Genome Browser
Species Human (GRCh38)
Location 19:51927274-51927296
Sequence TATTCAGGGATAGCGCGGGA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 41}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167820937_1167820946 18 Left 1167820937 19:51927274-51927296 CCGTCCCGCGCTATCCCTGAATA 0: 1
1: 0
2: 0
3: 0
4: 41
Right 1167820946 19:51927315-51927337 ACTTTACCTTCCGTACGTGCAGG 0: 1
1: 0
2: 0
3: 0
4: 48
1167820937_1167820949 30 Left 1167820937 19:51927274-51927296 CCGTCCCGCGCTATCCCTGAATA 0: 1
1: 0
2: 0
3: 0
4: 41
Right 1167820949 19:51927327-51927349 GTACGTGCAGGATTCAAAGATGG 0: 1
1: 0
2: 1
3: 2
4: 68
1167820937_1167820944 -8 Left 1167820937 19:51927274-51927296 CCGTCCCGCGCTATCCCTGAATA 0: 1
1: 0
2: 0
3: 0
4: 41
Right 1167820944 19:51927289-51927311 CCTGAATACTTGGGCAGAAAAGG 0: 1
1: 0
2: 0
3: 15
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167820937 Original CRISPR TATTCAGGGATAGCGCGGGA CGG (reversed) Exonic
903697347 1:25217720-25217742 TATTCTGGGATGGCTCTGGAGGG - Intergenic
906295481 1:44646633-44646655 TAATCAGGGATGGCGCCCGAGGG + Intronic
915170954 1:153977068-153977090 TATCCATGGACAGCGCAGGAGGG - Intronic
916804226 1:168243215-168243237 TATGCAGGGAGAGGGAGGGAGGG - Exonic
919407592 1:197203945-197203967 GATTCAGGGAAAGGGTGGGAGGG - Intergenic
1073971261 10:109047389-109047411 CAGTCAGGGATAGTGCGAGATGG + Intergenic
1081189022 11:40080703-40080725 TATTCAAGGCTAGGGTGGGAGGG + Intergenic
1106026570 13:25960806-25960828 TGGTCAGGGATAGCTTGGGAGGG - Intronic
1120168547 14:81225856-81225878 TATGCAGGAGTAGCGCAGGAAGG - Intergenic
1125770130 15:42159674-42159696 TGTGCTGGGATAGCGCAGGAAGG - Exonic
1135601380 16:23786667-23786689 TATTCAGGCAAAGTGCAGGAAGG + Intergenic
1135601905 16:23790825-23790847 TATTCAGGCAAAGTGCAGGAAGG - Intergenic
1137613365 16:49833774-49833796 TTTTCAGGGATTTCGTGGGAAGG + Intronic
1138619398 16:58198721-58198743 TATTCAGGGAAGGCTCTGGAAGG - Intergenic
1144062595 17:11597333-11597355 TATCCAGGTATAGGGCAGGATGG + Intergenic
1146921051 17:36712051-36712073 TATTCAGGGTTAGAGAGGGCGGG + Intergenic
1152633054 17:81419374-81419396 CATTCCGGGAAAGCGCGGGGAGG - Intronic
1167820937 19:51927274-51927296 TATTCAGGGATAGCGCGGGACGG - Exonic
926101437 2:10120731-10120753 GACTCAGGTTTAGCGCGGGAGGG + Intergenic
927482793 2:23467780-23467802 AATTCAGGGAGAGAGCTGGAGGG + Intronic
944835692 2:203577162-203577184 TGTTGAGGGATAGCGGGTGAGGG - Intergenic
1170554238 20:17502981-17503003 TGTTGAGGGATGGGGCGGGAGGG + Intronic
951468282 3:23026544-23026566 TAATCAGGGGTAGAGTGGGAGGG + Intergenic
953871892 3:46634087-46634109 TATTCAGAAATAGCCCGAGATGG - Intergenic
954139442 3:48597280-48597302 TGTTCAGGGAAAGCTTGGGAGGG - Intergenic
961855096 3:129862191-129862213 TATACAGGGATAGAGCAGGTGGG + Intronic
964285626 3:155114729-155114751 TATTCAGGGGTGGGGTGGGAAGG + Intronic
981261383 4:142723951-142723973 TATTGAGGAATAGCTAGGGATGG - Intronic
985026632 4:185745169-185745191 TAATCAGGGATGGAGAGGGAGGG + Intronic
985376028 4:189339319-189339341 TAGTCAGGGAAAGAGCAGGATGG - Intergenic
996568442 5:124906707-124906729 TATTCTGGGATTGCTCAGGAAGG - Intergenic
998946950 5:147350171-147350193 TATCAAGGGATAGCGGGGGGCGG - Intronic
1001506273 5:172283402-172283424 TCTTCAGGGCTGGGGCGGGAAGG + Intronic
1015809667 6:137149043-137149065 TGTTCATGAATAGTGCGGGAAGG - Intronic
1019451603 7:1101531-1101553 TGTTCAGGAATAGCCGGGGAAGG - Intronic
1024359144 7:48449518-48449540 TATTCAGGGTTAGCCAGGGCTGG + Intronic
1030892876 7:115022485-115022507 TATTCACTGATAGCACTGGATGG + Intergenic
1032086267 7:128885376-128885398 TTTGCAGGGATATGGCGGGAAGG + Intronic
1035015825 7:155765028-155765050 TATTCAGGGATGGCACCTGAAGG - Intronic
1038058650 8:23886997-23887019 TATTCAGGGATAACAAGGGGAGG + Intergenic
1056577361 9:87866718-87866740 TATTCAGGGATAGGGCAGCTTGG - Intergenic
1056607900 9:88102196-88102218 TTTTCAGGCATAGAGAGGGAGGG + Intergenic