ID: 1167822516

View in Genome Browser
Species Human (GRCh38)
Location 19:51941488-51941510
Sequence GGGGGCACAGAGTCCAAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 213}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167822516 Original CRISPR GGGGGCACAGAGTCCAAGAT AGG (reversed) Intronic
900604365 1:3517195-3517217 GGGGGCACAGAGCCCATGGCAGG + Intronic
900680918 1:3915746-3915768 GGGGCCACAGTGTCCCAGGTGGG - Intergenic
901651324 1:10744735-10744757 AGGGGAACACAGTCCCAGATGGG + Intronic
903014111 1:20350766-20350788 GGGGGAACAGAGGCCTAGAGAGG - Intronic
903182994 1:21614534-21614556 GGGGCCACAGAGTCACAGGTTGG - Intronic
903215031 1:21839094-21839116 GGGGACACAGAGGTCAGGATTGG + Intronic
903780038 1:25815207-25815229 GGGAGCACGGAGTTCAGGATGGG + Intronic
903810144 1:26030763-26030785 GGGGAAACTGAGGCCAAGATTGG - Intronic
904498315 1:30900162-30900184 GGGGGCACAGAGGCCCTGAGAGG - Intronic
905207966 1:36353686-36353708 GGGGGCACAAAGGCCAAGCGCGG + Intronic
905806431 1:40880880-40880902 TGGGGCACAGAGTGCATGATAGG + Intergenic
906183519 1:43841427-43841449 GAGTGCACAGAGTGCAAGAATGG - Intronic
908564889 1:65344240-65344262 GATGGCAAAGAGTCAAAGATAGG + Intronic
908794669 1:67819169-67819191 GGGGGCAGGGTGTCCAAGCTAGG + Intronic
911027742 1:93452640-93452662 TGGAGCACAGAGTTCAAGACTGG - Intronic
915025903 1:152829247-152829269 GGGAGCACGCAGTCCAAGTTGGG - Intergenic
915061514 1:153189821-153189843 GGGGACACAGAGTCAAAGAAAGG + Intergenic
915147148 1:153801961-153801983 GTGTCCACAGAGTCCAAGACTGG + Intergenic
915802857 1:158812958-158812980 GGGGAAACAGACCCCAAGATAGG + Intergenic
916717235 1:167455865-167455887 GTGGGCACAGTGGCCAGGATCGG + Intronic
921154698 1:212430120-212430142 GGGGTCACAGGGTCCATGGTGGG + Intergenic
922442261 1:225665630-225665652 GGGGGCAGGAAATCCAAGATGGG + Intergenic
923784869 1:237056915-237056937 GGAGGCCCAGAGTCCGAGATGGG - Intronic
924294090 1:242567931-242567953 GGGGCCCCAGATGCCAAGATTGG - Intergenic
1063014403 10:2061354-2061376 GGGGGCACAGCATCCAATATGGG - Intergenic
1065259977 10:23914119-23914141 GGGGATACAGAAGCCAAGATTGG + Intronic
1067686688 10:48470045-48470067 AGGGACACAGAGTCCAGGATAGG + Intronic
1069723488 10:70563698-70563720 TTGGGCTCAGAGGCCAAGATGGG + Intronic
1069921871 10:71820410-71820432 GGGGACACAGAGACCAGGGTGGG + Intronic
1071171033 10:82864122-82864144 GGGGGCACAGAGTTTCTGATTGG + Intronic
1074598705 10:114891321-114891343 GGGGGCATAGAGACATAGATGGG + Intronic
1075254814 10:120917280-120917302 GGGGACACAGAGACCAAGCCTGG + Intergenic
1076476511 10:130757513-130757535 TGGAGCTCAGAGTCCAAAATGGG + Intergenic
1077532562 11:3104020-3104042 GGGGGCCCTGTCTCCAAGATGGG - Intronic
1078721218 11:13884927-13884949 TGGAGCACAGGGTCCTAGATGGG + Intergenic
1079094989 11:17504322-17504344 AGGCCCACAGAGGCCAAGATGGG - Intronic
1080298001 11:30752399-30752421 GTGGGCAAAGAGACCAAGTTTGG - Intergenic
1082990802 11:59205798-59205820 GAGGGCACAGAGCCCAGCATGGG - Exonic
1083267383 11:61553049-61553071 GGGGGCCCAGACTCCAGGGTGGG - Intronic
1083673113 11:64310880-64310902 GGGTGCACAAAGTTTAAGATTGG - Intronic
1084765399 11:71305156-71305178 GTGAGGACAGAGGCCAAGATTGG + Intergenic
1085491098 11:76917987-76918009 GGAGGGAGAGAATCCAAGATGGG - Intronic
1089616903 11:119699927-119699949 GGGGGAACAGAGACCCAGAGAGG - Intronic
1089768250 11:120784207-120784229 GGGGGTTCCGAGTCCAAGCTAGG - Intronic
1092005012 12:5061756-5061778 GGGGTCTCAGAGTCCAACAATGG + Intergenic
1093785449 12:23187292-23187314 GGGGAAACAGAAGCCAAGATAGG - Intergenic
1096111275 12:49030706-49030728 GGGGGCAAAGAGGCTAAAATTGG + Exonic
1098154691 12:67585506-67585528 GTGGACACAGAGTCCAATCTAGG + Intergenic
1099627195 12:85090156-85090178 AGGTGCACAGAGTGCAAGAGTGG + Intronic
1104858512 12:131912946-131912968 GGAGGCGCAGAGTCCAAGTGGGG + Intronic
1107199859 13:37701559-37701581 AGGGCCACAGAGACCAGGATGGG - Intronic
1108695571 13:52899782-52899804 AGGGTCACAGATTCCAGGATAGG + Intergenic
1114610803 14:24038972-24038994 TGGTGGACAGAGCCCAAGATTGG + Intergenic
1114918535 14:27296862-27296884 AGGTGCACAGAGTGCAAGAGTGG - Intergenic
1116972157 14:51077287-51077309 GGTGACACAGTGGCCAAGATAGG + Intronic
1117846986 14:59921524-59921546 AGGGGGATAGAGTCAAAGATTGG + Intronic
1119689749 14:76662331-76662353 TGGGCCACAGAGCCCCAGATTGG + Intergenic
1121262564 14:92577073-92577095 GGAGGCACAGAGTCCATGGTGGG - Intronic
1122125971 14:99579060-99579082 TGAGGCACAGAGCCCAAGAGAGG + Intronic
1123472353 15:20564800-20564822 TGGGACAAAGGGTCCAAGATAGG + Intergenic
1123625544 15:22224646-22224668 GGGGACACAGAGCCCAGGAGAGG + Intergenic
1123645650 15:22435553-22435575 TGGGACAAAGGGTCCAAGATAGG - Intergenic
1123666906 15:22615118-22615140 TGGGACAAAGGGTCCAAGATAGG - Intergenic
1123732658 15:23159791-23159813 TGGGACAAAGGGTCCAAGATAGG + Intergenic
1123750791 15:23357171-23357193 TGGGACAAAGGGTCCAAGATAGG + Intronic
1124283162 15:28381087-28381109 TGGGACAAAGGGTCCAAGATAGG + Intronic
1124299537 15:28530526-28530548 TGGGACAAAGGGTCCAAGATAGG - Intronic
1124320746 15:28709691-28709713 TGGGACAAAGGGTCCAAGATAGG - Intronic
1124338806 15:28876692-28876714 GGAGGCACAGAGCCCAGGACAGG + Intergenic
1124563247 15:30794182-30794204 TGGGACAAAGGGTCCAAGATAGG + Intergenic
1124705441 15:31960170-31960192 AGGTGCACAGAGTGCAAGAGTGG + Intergenic
1124960039 15:34387051-34387073 TGGGACAAAGGGTCCAAGATAGG - Intronic
1124976668 15:34533272-34533294 TGGGACAAAGGGTCCAAGATAGG - Intronic
1125293633 15:38177513-38177535 GGGGGCACTCAGTCAGAGATAGG + Intergenic
1126061780 15:44789826-44789848 GGCAGCACAGAGGCCAAGGTAGG + Intergenic
1127241487 15:57120255-57120277 GGGAGCACTGAATCCAAGTTGGG - Intronic
1127390737 15:58503352-58503374 GAGGGGGCAGAGTCCAAGGTAGG + Intronic
1128815215 15:70603175-70603197 GGGGGCCCAGAATCCTAGGTGGG + Intergenic
1130259968 15:82346992-82347014 TGGGGAAAAGGGTCCAAGATAGG - Intronic
1131392345 15:92059562-92059584 GGGGGCACAGAGCTCACGGTGGG - Intronic
1132686101 16:1162764-1162786 GGGAGGACAGTGTCCAAGCTGGG + Intronic
1135870452 16:26145073-26145095 GGGTCCACAGAGGCAAAGATGGG + Intergenic
1137807441 16:51320813-51320835 GGGGGCTGAGAGTCCAAGAAGGG - Intergenic
1138190105 16:55007733-55007755 TGGTGCACAGACCCCAAGATGGG + Intergenic
1138215762 16:55203946-55203968 GGGGGCAGAGACTTCATGATGGG + Intergenic
1140259059 16:73361640-73361662 GGGGGGAAGGAGACCAAGATTGG - Intergenic
1141275008 16:82579490-82579512 GTGGGCACAGGGTCCAAGCTAGG + Intergenic
1141649183 16:85384138-85384160 GGGGGCACAGACTCAAAGGAGGG + Intergenic
1142582745 17:952184-952206 GGGGTCAGAGAGACCAAGGTTGG + Intronic
1143072434 17:4307875-4307897 GGGGGCACACAGGCCAAGACAGG + Intronic
1143180960 17:4983872-4983894 AGGGGCACAGAGGCCAGGAGTGG - Intronic
1143303257 17:5926715-5926737 GGTGGCACAGAGTCTCAGAAAGG + Intronic
1143523668 17:7460761-7460783 TGGGGAACTGAGTCAAAGATGGG + Exonic
1144720604 17:17467057-17467079 GGGGGAACAGATCCCAGGATTGG - Intergenic
1145942050 17:28747715-28747737 AGGGGCAAAGAGCCCAAGAGAGG + Intronic
1146262662 17:31431998-31432020 GGGGTCCCAGAGCCCAGGATGGG + Intronic
1147291956 17:39450920-39450942 AGGGGCATAGAGTCCAGGAGAGG - Intronic
1147338162 17:39739206-39739228 GGGAGAGCAGAGTCCAAGACCGG - Intronic
1147391246 17:40110631-40110653 GGGGGCTGAGATTTCAAGATAGG + Intergenic
1148469605 17:47885011-47885033 TGGGGCACAGAGTCCAGAAGCGG - Intergenic
1148973514 17:51505894-51505916 TGGGGCACAGGGTCCAGGAGAGG + Intergenic
1150729181 17:67677133-67677155 GGGAGCACAGACCCCAAGAAAGG + Intronic
1152571729 17:81124035-81124057 GAGGGGACAGTGTCCATGATGGG + Intronic
1157428371 18:47602864-47602886 GGGGGCACAGACTGGAAAATCGG + Intergenic
1160592266 18:79951327-79951349 GGGGGCGCAGGGCCCAGGATCGG + Intronic
1161124316 19:2547276-2547298 CTGGGCTCAGAGTCCAACATGGG + Intronic
1161345411 19:3766735-3766757 GGGGACACAGAAGCCAAGACGGG + Intronic
1162322642 19:9979033-9979055 GGGGGCCCTGAGTCACAGATTGG - Intronic
1162386541 19:10363521-10363543 GGTGACACACACTCCAAGATTGG + Intronic
1162785131 19:13030051-13030073 GGCGGCACAGGGTCCATGGTGGG - Intronic
1162919012 19:13889564-13889586 GGGAGCGGAGAGTCCATGATGGG - Exonic
1163696998 19:18769062-18769084 GGGGCCAGAGAGGCCAAGAAGGG - Intronic
1164769679 19:30799138-30799160 GGGGGCAGAGAATCCCAGAGAGG + Intergenic
1166343068 19:42150269-42150291 GGGAGCACAGAGGCCTAGATGGG + Intronic
1167384813 19:49157234-49157256 GGGGGGACAGAGACCCAGAGAGG - Intergenic
1167443826 19:49525759-49525781 GGGGGAACAGAGACCCAGAGGGG + Intronic
1167470549 19:49673407-49673429 TGGGGGACAGAGTCAGAGATGGG - Intronic
1167631065 19:50626507-50626529 GGGGGGACAGAGACCCAGAGAGG + Intronic
1167701725 19:51052001-51052023 GGGAGGACAGAGTGAAAGATTGG - Intergenic
1167822516 19:51941488-51941510 GGGGGCACAGAGTCCAAGATAGG - Intronic
1167932172 19:52874841-52874863 GGGGCCAGAGAGTCCTAGGTAGG + Intronic
1168308807 19:55450864-55450886 GGGGGGACAGAGACCCAGAGAGG + Intergenic
1168308830 19:55450952-55450974 GGGGGGACAGAGACCCAGAGAGG + Intergenic
925332224 2:3067473-3067495 GGGGGCACTGAGGCTCAGATGGG + Intergenic
928615796 2:33038380-33038402 TGGGGCACAGAGACAAAGCTTGG - Intronic
931534746 2:63261883-63261905 GATGGGACAGTGTCCAAGATTGG + Intronic
932060807 2:68495785-68495807 GGGTACACAGAGTGCAAGAGTGG - Intronic
932097070 2:68860424-68860446 GGGAGCTGAGAGCCCAAGATGGG - Intergenic
932315754 2:70780988-70781010 GGGGACTCAGAGCCCAAGCTGGG + Intronic
934990210 2:98915221-98915243 GGGGGCACAGAGTGCTGGAGAGG + Intronic
936539738 2:113340571-113340593 TGGGGCTCAGAGTTCAGGATAGG + Intergenic
937472407 2:122185593-122185615 AGAGGCAGAGAGTCCCAGATAGG + Intergenic
937505760 2:122534752-122534774 GGGGGTACAGAGTCGAACCTTGG + Intergenic
937866899 2:126759296-126759318 TGGGGCCCAGAGTTCAAGACAGG + Intergenic
938164985 2:129018285-129018307 TCGAGCCCAGAGTCCAAGATTGG - Intergenic
938489634 2:131754883-131754905 GGGGGCACAAAGTCCATGAAGGG + Intronic
946015673 2:216602302-216602324 GAGGGAACTGAGGCCAAGATGGG + Intergenic
946046377 2:216824564-216824586 GGGGGTACAGTGTCCAAGACAGG - Intergenic
946352014 2:219161291-219161313 GGTTGTACAAAGTCCAAGATAGG - Intronic
947833569 2:233159212-233159234 GGGGGCACAGAGGCCCAGCCTGG - Intronic
1168876287 20:1174381-1174403 GGTGGCTCAGAGTCCAAGTAGGG + Intronic
1168980477 20:1999260-1999282 TGGAGCACAGAGTGAAAGATGGG + Intergenic
1169472689 20:5901710-5901732 AAGGGGACAGAGTCCATGATTGG - Intergenic
1171176257 20:23052387-23052409 GGGGGCACAGATAGGAAGATAGG - Intergenic
1171784730 20:29451986-29452008 GGGAGGACAGAGTGAAAGATTGG - Intergenic
1172009172 20:31836453-31836475 GGGGAAACCGAGGCCAAGATGGG + Intergenic
1173841770 20:46162070-46162092 TGGGCCACAGAGTCCACCATAGG - Intergenic
1173848840 20:46205111-46205133 GGGGGAAAAGAGTCACAGATAGG - Intronic
1174614764 20:51827324-51827346 GGGGCCACAGTGTCCGTGATCGG - Intergenic
1175446505 20:59023848-59023870 GGGGGCACAGGCTCCGGGATGGG + Exonic
1175689744 20:61056834-61056856 GGCTGCAGAGAGTCTAAGATAGG - Intergenic
1179398100 21:41059732-41059754 AGGGACACAGAGTCCCAGAGAGG - Intergenic
1179466397 21:41577584-41577606 AGGGTCACAGAGACAAAGATTGG - Intergenic
1179631671 21:42682689-42682711 AGGGTCACAGCCTCCAAGATGGG - Intronic
1181068930 22:20320563-20320585 GGGGCCACGGAGGCCCAGATGGG - Intergenic
1182463980 22:30503113-30503135 GTGGGCACAGAGTCCAGGTGAGG - Intronic
1183264835 22:36818743-36818765 GGAGGCACAGAGTCCGTGAATGG + Intronic
1185222311 22:49635245-49635267 GGGGACACAGAGTCCCACCTGGG + Intronic
949483936 3:4519551-4519573 GTGGGCTCAGAATCCAAGGTAGG - Intronic
950341213 3:12246570-12246592 GGGGGCAAATAGTCCAGGATAGG - Intergenic
950776086 3:15351745-15351767 AGGTGCACAGAGTGCAAGAATGG + Intergenic
952526497 3:34216091-34216113 GGCAGCACAGAGGCCAAGGTAGG - Intergenic
953468747 3:43148723-43148745 GGGGAAAGAGAGTCCAAGAAGGG - Intergenic
961915971 3:130375511-130375533 GGGAGAACAGAGTCTAAGATGGG - Intronic
962067423 3:131996508-131996530 GGGGAGAGAGAGTCCACGATAGG + Intronic
963261068 3:143191515-143191537 GGGGACACGGAGTCAAAGAGGGG - Intergenic
965458150 3:168929762-168929784 GGGGCCACAGAGTCCTTGCTGGG - Intergenic
966600289 3:181768267-181768289 GAGGGCAGAGAAGCCAAGATCGG + Intergenic
967942032 3:194773488-194773510 GGGGGCTCACAGTCCAAGGAAGG + Intergenic
968433249 4:571924-571946 GGGTGCACAGAGACCTAGCTGGG - Intergenic
968741691 4:2334601-2334623 GTGGGCACAGAGGCCACGACTGG - Intronic
972325363 4:38010474-38010496 GTGGGCCTAGAGTCCAAGACAGG - Intronic
976453526 4:85219426-85219448 AGGTGCACAGAGTGCAAGAGTGG + Intergenic
984233203 4:177124856-177124878 GAGGTCACAGAGTCAATGATGGG - Intergenic
986419831 5:7568542-7568564 GTGAAAACAGAGTCCAAGATGGG + Intronic
987663297 5:20905059-20905081 AGGTGCACAGAGTGCAAGAGTGG - Intergenic
988759391 5:34297128-34297150 AGGTGCACAGAGTGCAAGAGTGG + Intergenic
989356400 5:40548302-40548324 GGGGGCAAACAGGCCAAAATGGG - Intergenic
989471596 5:41825806-41825828 GTGGGTACAAAGTCCAAGACTGG - Intronic
996872456 5:128206643-128206665 GGGCTCACAGAGCCCAAGAGAGG + Intergenic
998918887 5:147045775-147045797 TGGAGCACAGAGACCAAGATGGG - Intronic
999152736 5:149437049-149437071 AGGGGCACAGAGGCCAGGTTGGG + Intergenic
1002858225 6:1056686-1056708 GGTGGCTCAGTGTCCCAGATAGG - Intergenic
1003046700 6:2740065-2740087 GGTGGCATAGAGTGCAAGCTAGG + Intronic
1003360063 6:5416887-5416909 GACGGCACAAAGGCCAAGATGGG - Intronic
1003935858 6:10974613-10974635 CGAGGCCCAGAGTTCAAGATCGG - Intronic
1005228580 6:23672128-23672150 GGAAGCAAAGAGTACAAGATTGG - Intergenic
1006083669 6:31581636-31581658 AGGGGCAAAGAGTCCACGATTGG + Intronic
1006295327 6:33167588-33167610 GGGGGCAGAGGGTCCAAGGTGGG + Intronic
1006844723 6:37054345-37054367 GGAGGCAGAGAGTCAAAGAGGGG - Intergenic
1008840552 6:55898013-55898035 GGTGTCACAGAAACCAAGATAGG + Intergenic
1010931797 6:81812698-81812720 CGGAGCAGAGAGACCAAGATTGG + Intergenic
1012624796 6:101392832-101392854 GAGGTCGCAGACTCCAAGATTGG - Intergenic
1015415205 6:132940224-132940246 GGAGCCAGAGAGGCCAAGATTGG - Intergenic
1022451901 7:30523569-30523591 TGGGACAAAGCGTCCAAGATAGG - Intronic
1022510129 7:30929750-30929772 TGGGGCACATAGTCCAAGGCTGG + Intergenic
1023279669 7:38556636-38556658 GGGGGCAGAGAGTGCAGGAGTGG - Intronic
1024941493 7:54767730-54767752 GGGGGCCTAGGGTCCATGATAGG + Intergenic
1027708793 7:81570700-81570722 GGGAGCACAGAGTGCAGGCTAGG + Intergenic
1028856090 7:95596135-95596157 GGGGACACAGGGCCCAAGCTGGG - Intronic
1030161002 7:106508498-106508520 GGGGGCACAGATTACAAGGCTGG + Intergenic
1032975435 7:137217331-137217353 GGTGCCACACAGTCCAAGTTAGG + Intergenic
1034734113 7:153412938-153412960 GGCGGCAGAGAGACTAAGATGGG + Intergenic
1035030795 7:155857432-155857454 GGGGGGACTGAGGCCAAGAAAGG - Intergenic
1036710371 8:11074667-11074689 GGAAGCACACAGTCCAAGGTGGG + Intronic
1037731144 8:21524817-21524839 GCTGGAACAGAGTCCAAGGTGGG - Intergenic
1038420120 8:27428753-27428775 TGGGGCACAGAGTGCAAAATTGG + Intronic
1044429835 8:92095700-92095722 GGGGGCTCAGACCCCAGGATGGG + Intronic
1048340299 8:133533569-133533591 TGGGGCACAGAGTGCAAGTCAGG - Intronic
1048950165 8:139489942-139489964 GAGGGCACAGCTTCCAAGACAGG - Intergenic
1049528262 8:143140512-143140534 GGAGGCAGAGAGGCCAGGATGGG + Intergenic
1049749806 8:144277735-144277757 TGGGGCACAGAGTCCACCAGGGG + Intronic
1049784988 8:144446213-144446235 GGGTGCACAGAGTCCAACTGAGG + Intergenic
1053324630 9:37132455-37132477 AGGGGCACAGAGTTATAGATAGG - Intronic
1053568018 9:39273863-39273885 CTGGGCACAGTGGCCAAGATGGG + Intronic
1054129127 9:61345147-61345169 CTGGGCACAGTGGCCAAGATGGG - Intergenic
1057891690 9:98874614-98874636 GGGGAGACTGAGACCAAGATTGG - Intergenic
1058555196 9:106159429-106159451 GGGGGCACAGAGAACGAGAAGGG + Intergenic
1058753131 9:108059054-108059076 GGGGGCAAAGAGAGCAGGATTGG + Intergenic
1058913906 9:109546959-109546981 GGCAGCTCAGAGTGCAAGATGGG + Intergenic
1060667787 9:125443315-125443337 GGGGACACTGAGTCCCAGAAAGG + Intronic
1061195191 9:129103527-129103549 GGGGACACAGAGGCCCAGAGTGG - Intronic
1187124026 X:16436602-16436624 GGGGGCACATAGTCTAAGCTTGG + Intergenic
1188166582 X:26871062-26871084 AGGTGCACAGAGTGCAAGAGTGG - Intergenic
1188261856 X:28032805-28032827 GGGGCCACAGAAGCTAAGATGGG + Intergenic
1189472828 X:41327509-41327531 GGGGGCAAAGTGCACAAGATGGG + Intergenic
1190237346 X:48626582-48626604 GGGGGCACAGACACCAGGATGGG + Intergenic
1199714353 X:150495671-150495693 GGGGACACAGAGTCAGAGAGGGG + Intronic
1200257273 X:154590135-154590157 GCGGGGACAGAGTTCAAGAAAGG + Intergenic
1200260497 X:154614267-154614289 GCGGGGACAGAGTTCAAGAAAGG - Intergenic
1202366668 Y:24170529-24170551 TGGGACAAAGGGTCCAAGATAGG + Intergenic
1202373735 Y:24214952-24214974 TGGGACAAAGGGTCCAAGATAGG - Intergenic
1202497046 Y:25455168-25455190 TGGGACAAAGGGTCCAAGATAGG + Intergenic
1202504114 Y:25499594-25499616 TGGGACAAAGGGTCCAAGATAGG - Intergenic