ID: 1167822771

View in Genome Browser
Species Human (GRCh38)
Location 19:51944190-51944212
Sequence TGCCATAAACATAATGCATT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 188}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167822771 Original CRISPR TGCCATAAACATAATGCATT TGG Exonic
903528654 1:24012640-24012662 TCCCATGAAGAAAATGCATTTGG - Intergenic
905911402 1:41657445-41657467 TGCCATAAACATCAGTCTTTGGG - Intronic
908149509 1:61285446-61285468 TGTAATATACATAATGTATTTGG + Intronic
908425741 1:64005453-64005475 TGCTATTACCATAATGCTTTTGG + Intronic
908553725 1:65235685-65235707 TGAGAAAAACATAATGCAGTCGG + Intergenic
909924335 1:81421222-81421244 TGCAATAAACCTAAGGTATTAGG - Intronic
912022080 1:105117901-105117923 TGCCAGAAAAATAATTCATAAGG + Intergenic
912677116 1:111693231-111693253 TGCCATAACCATAATGGGGTGGG + Intronic
912796863 1:112698661-112698683 TGCCATTAACCTAATGCAAGAGG - Intronic
914437429 1:147672094-147672116 TTCCATCAACATCTTGCATTTGG - Intergenic
915860695 1:159441137-159441159 TGTCATAAACATACTCCAATAGG - Intergenic
916287213 1:163121454-163121476 TGCCTTCAACATAAGGCATTTGG + Intronic
916423048 1:164654104-164654126 TTCCGTAAACACAGTGCATTGGG + Intronic
916611967 1:166400063-166400085 TTCACTTAACATAATGCATTTGG + Intergenic
917743328 1:177983196-177983218 TGCTATAAAATGAATGCATTGGG - Intronic
918880796 1:190118029-190118051 GCCCAAAAACATAATGCATTTGG - Intronic
920649966 1:207830255-207830277 TGACATAAAGATTTTGCATTTGG + Intergenic
923303656 1:232667675-232667697 TACCATAAAGCTAATACATTCGG + Intergenic
1063254143 10:4308011-4308033 TGCCAACAACAGAATGCATTTGG - Intergenic
1063580608 10:7303086-7303108 TTTCATAACCAGAATGCATTTGG + Intronic
1064856815 10:19777831-19777853 TGCCTTACATAGAATGCATTTGG + Intronic
1069216168 10:65824022-65824044 TGAGACAAACAAAATGCATTTGG - Intergenic
1069946633 10:71990869-71990891 TCCCATGAACATTATGTATTAGG + Intronic
1070053071 10:72907695-72907717 TCCCATAAACACAAAGCATATGG - Intronic
1071110267 10:82147534-82147556 TGCCATCAGCATAATACTTTTGG - Intronic
1071903560 10:90147124-90147146 TGCCAATAATAAAATGCATTAGG + Intergenic
1071965931 10:90852800-90852822 TGACATTAGCATCATGCATTGGG - Intronic
1072612364 10:97026590-97026612 TGCCAAATTCTTAATGCATTTGG + Intronic
1076561032 10:131363913-131363935 TACCTTAAATATAGTGCATTGGG + Intergenic
1077751608 11:4976892-4976914 TGGCACAAACATAATGACTTAGG - Intronic
1079033641 11:17004077-17004099 AGCAATAAACATGATGCATCTGG + Intronic
1080406250 11:31982164-31982186 TGCCACAAACATATTGTATAAGG + Intronic
1080631969 11:34085912-34085934 TGGCATAAATGTAATTCATTTGG + Intronic
1081477170 11:43445958-43445980 TGCCATAGACATAATGTAACTGG + Intronic
1082938437 11:58678379-58678401 TGCTATAAACATACTGCAAGTGG + Intronic
1083661577 11:64253969-64253991 TGCCTTAAACATTCTGCAGTGGG + Intronic
1084695379 11:70750506-70750528 TGCCATAAACTTACTGCAAATGG - Intronic
1085331429 11:75655200-75655222 TTCCATAATAATAATGCAGTGGG - Intronic
1087734133 11:101812477-101812499 TGCCAAAAACAGATTGCATAAGG - Intronic
1089988792 11:122838333-122838355 TGCCATCAAGATAATACATGTGG + Intergenic
1090166265 11:124552015-124552037 TGGCATAAAGATCAGGCATTGGG - Intergenic
1092044554 12:5421202-5421224 TGGCAGAAACATTATGCTTTGGG + Intergenic
1092084032 12:5741029-5741051 TGCCATGAACATAGGGCAGTAGG - Intronic
1096108192 12:49011288-49011310 GCCCATAAACATATTGGATTTGG + Intronic
1097859655 12:64506139-64506161 TGACATAAACAGAATGCACAAGG + Intergenic
1099061238 12:77912033-77912055 TGCCATAAACTCAATGCAGTAGG - Intronic
1099456950 12:82875191-82875213 TGCCCTAAACATAATCTCTTTGG - Intronic
1100424526 12:94471557-94471579 TGCAAGAAACAGAATGCTTTAGG + Intergenic
1103042066 12:117703963-117703985 TAACATAAACAGAAAGCATTTGG + Intronic
1103795504 12:123500228-123500250 TGCCATAAAGGTAATACATGAGG - Intronic
1105414636 13:20199029-20199051 TGAAATAAACATAAAGCATTTGG - Intergenic
1108052330 13:46458591-46458613 TGTCTTAAACATTAGGCATTAGG + Intergenic
1108054117 13:46468855-46468877 TTCCATATACATAATGTATAGGG + Intergenic
1108281131 13:48863324-48863346 TTCCATAAACATAATGTGTCAGG + Intergenic
1109430744 13:62230657-62230679 TACCATAAACTTAATGATTTAGG - Intergenic
1109538957 13:63747621-63747643 TGTCTTAAACATTAGGCATTAGG - Intergenic
1109544886 13:63832211-63832233 TGTCTTAAACATTAGGCATTAGG + Intergenic
1110300639 13:73922825-73922847 TGCCAGAAAAATCATGCACTAGG + Intronic
1110533493 13:76624196-76624218 TGCTATAAACATAACTTATTAGG - Intergenic
1114129736 14:19776682-19776704 TCCCATAAACATAATTGCTTTGG + Intronic
1115343111 14:32313130-32313152 TGGCATAAAGATGCTGCATTTGG + Intergenic
1116312013 14:43339777-43339799 TGCCATAAAAATAAATCATATGG + Intergenic
1120518710 14:85500994-85501016 TGACATAAACATATCCCATTAGG - Intergenic
1122098386 14:99387866-99387888 TTCCATCAACATTATGCATGTGG - Intergenic
1125840874 15:42800359-42800381 TGACATACACACAATGCCTTAGG + Intronic
1130640562 15:85670029-85670051 TACAATAAACTTAATGTATTAGG - Intronic
1131099590 15:89677616-89677638 TGCCCTGAACAGAAGGCATTAGG + Intronic
1131477739 15:92754778-92754800 TGCCATCTACATACTGAATTAGG - Intronic
1133866840 16:9652020-9652042 TTCCATAATTATAATGTATTAGG + Intergenic
1133870135 16:9678224-9678246 TGCCATTAGCATGATCCATTGGG + Intergenic
1135419591 16:22297118-22297140 TGGCATAAACATATTGCAGCTGG + Intergenic
1135721268 16:24820528-24820550 TGCAATAACATTAATGCATTAGG + Intronic
1139154140 16:64420643-64420665 AAGCATAAACAAAATGCATTAGG + Intergenic
1140066888 16:71619040-71619062 TGCCATAAACATACTGTAAAGGG + Intergenic
1140501283 16:75435601-75435623 TGTCAGAGACATAATGCATATGG + Intronic
1144192269 17:12857551-12857573 TCCAATCAACATAATGAATTTGG + Intronic
1150067077 17:62119696-62119718 TGCTGAAAACATAATGCCTTTGG + Intergenic
1153228713 18:2916985-2917007 TAACATAAACTGAATGCATTTGG - Exonic
1153378799 18:4412343-4412365 TGGCATAAACATGATGCAGAGGG + Intronic
1153620331 18:6971309-6971331 TTCCAGAAATAAAATGCATTAGG - Intronic
1158184670 18:54758301-54758323 TGCCCTAAACATAATGGCTCAGG - Intronic
1158867566 18:61652562-61652584 TGCCATGAACATAGAGCAATGGG - Intergenic
1158885599 18:61823997-61824019 TGACATAAACAAAATGCACCTGG - Intronic
1160366111 18:78327415-78327437 TGCTATAAAAAGAATTCATTTGG - Intergenic
1167822771 19:51944190-51944212 TGCCATAAACATAATGCATTTGG + Exonic
1167832321 19:52035347-52035369 TACCATGAACATAATGCATTTGG - Exonic
925695619 2:6574962-6574984 TGACATAAAAATAATTAATTGGG - Intergenic
929844168 2:45504367-45504389 TGCAAAAAACATAAAGAATTTGG - Intronic
931893541 2:66702846-66702868 TGCCTTTAAGATAATACATTTGG - Intergenic
932016723 2:68036052-68036074 TGTCATAAACATAATTTCTTTGG - Intergenic
932927404 2:75993236-75993258 GGCCAAATACCTAATGCATTTGG + Intergenic
935385395 2:102493817-102493839 TGTCACAAACATAATTGATTTGG - Intronic
935842192 2:107125864-107125886 TGCCAAAAACATAGGGCACTTGG + Intergenic
937244799 2:120485721-120485743 TTCAATAAACACCATGCATTGGG + Intergenic
938187949 2:129249893-129249915 TGCCAAAAACCTAATGAACTTGG - Intergenic
938682902 2:133710495-133710517 TGACATAAAAATAATGAATTTGG - Intergenic
939411571 2:141833447-141833469 TGCAATATTCATATTGCATTTGG - Intronic
941225605 2:162843006-162843028 TGCCATTAAAATGCTGCATTAGG - Intergenic
941732643 2:168935255-168935277 CGCAATAAACATGATGCACTGGG + Exonic
942916175 2:181310056-181310078 TTCCATAAAGAGAATGCATTTGG - Intergenic
943214908 2:185019517-185019539 TTCCTTTAACTTAATGCATTTGG + Intergenic
943256768 2:185603503-185603525 TGACATAAACATAATTTATAGGG - Intergenic
945192134 2:207199808-207199830 TACCAAAAACTTAATACATTAGG - Intergenic
945997374 2:216449229-216449251 TTCAATCAACATAATGAATTTGG + Intronic
948428483 2:237902968-237902990 TGCCATAAACAGCCTGGATTGGG - Intronic
1168960854 20:1868662-1868684 TGACATAAACAAAATTCTTTGGG + Intergenic
1169489298 20:6057591-6057613 TGCCATACCCATAATTTATTTGG + Intergenic
1181665190 22:24390331-24390353 TGCTGTTAAAATAATGCATTAGG + Intronic
1183312538 22:37118522-37118544 TTCCATATACATAAGGCTTTAGG + Intergenic
952537918 3:34333262-34333284 TGCCATAAACATAAAATATAAGG - Intergenic
953145195 3:40268507-40268529 TGCCATAACCATGAAGCATTAGG + Intergenic
957206800 3:77209457-77209479 GGCAATAAACATAATTCATTAGG + Intronic
958028058 3:88072535-88072557 TGCCAGAAACATGTTTCATTTGG + Intronic
958431137 3:94043138-94043160 GGCCAAAAAAATAATGAATTTGG + Exonic
961052538 3:123759185-123759207 TGCTATGAAAACAATGCATTTGG - Intronic
962956474 3:140271402-140271424 TGCCATGTACATAATACACTGGG - Intronic
964898736 3:161630604-161630626 TGTGATAAACAAAATGCAATTGG - Intergenic
965115833 3:164486825-164486847 TGCCATAACCATAAAGCACAAGG - Intergenic
965689897 3:171344457-171344479 TCCCATAAAAACACTGCATTAGG - Intronic
970113778 4:12669846-12669868 TGCCATAACCACAGTGCAGTTGG + Intergenic
970137983 4:12947164-12947186 AGCCATTAAAATTATGCATTTGG + Intergenic
973604540 4:52573405-52573427 TACCCTAAACTAAATGCATTTGG - Intergenic
974314675 4:60263804-60263826 TGCCCTAAAAATGATGCTTTTGG - Intergenic
975883239 4:78936539-78936561 TGCTATATACATCATGTATTTGG - Intronic
977361071 4:96005578-96005600 TGCCATAAACATACCACATTTGG + Intergenic
978976612 4:114883231-114883253 AGCAATAAAAGTAATGCATTGGG + Intronic
980435118 4:132762693-132762715 TACATTAAACATAATGTATTTGG - Intergenic
982096206 4:151925808-151925830 TGCCATGTAGATAATGTATTGGG - Intergenic
983433395 4:167680272-167680294 TGCTATAAATATATTGCATATGG + Intergenic
983613067 4:169671479-169671501 GGACAAATACATAATGCATTTGG + Intronic
984925962 4:184807317-184807339 TGCCAAAAATATAATTCAATTGG + Intronic
985092451 4:186378108-186378130 TGCCATAAACACTATGTATGAGG - Intergenic
985205734 4:187534106-187534128 AGCAATGAACATAATGCACTTGG - Intergenic
986935833 5:12885204-12885226 AGCCTTAAACATACTGCATCAGG - Intergenic
986976165 5:13396883-13396905 GGCCCTAACCAAAATGCATTTGG - Intergenic
986984508 5:13485034-13485056 TGCTATAAATATAAAGCTTTTGG + Intergenic
987500283 5:18700179-18700201 TGTAATAAAACTAATGCATTTGG - Intergenic
989371894 5:40719020-40719042 TGGCATAAAGCTAATGCCTTAGG + Intronic
989561324 5:42855436-42855458 TAGCATAAGCATAATGCATCTGG + Intronic
990720364 5:58688277-58688299 TGCCATAAACAACATGCTCTTGG - Intronic
991249473 5:64543992-64544014 TGCCAAAAAGATGATGCTTTAGG + Intronic
991458910 5:66835866-66835888 TGCCATTAAAATCATGCTTTTGG + Intronic
993662269 5:90652643-90652665 AGCCATATACAAAATGCAATTGG + Intronic
994224041 5:97231416-97231438 TTCCATAAACATATTTGATTTGG + Intergenic
994637417 5:102360610-102360632 TACCTTAATGATAATGCATTCGG + Intergenic
999522782 5:152369577-152369599 TCCAATAAACATAATGGAGTTGG + Intergenic
999865600 5:155697295-155697317 TGCCAGAAACATACTGCTTCTGG - Intergenic
1000454135 5:161428120-161428142 TGAGAGAAACACAATGCATTAGG + Intronic
1001097809 5:168789351-168789373 ATCAATAAAAATAATGCATTTGG + Intronic
1001540700 5:172536095-172536117 TGCCATCAACAAAATGGATAAGG - Intergenic
1004040612 6:11971327-11971349 TGCCATTAAAATGATTCATTTGG - Intergenic
1004530900 6:16454668-16454690 TGCCATAGACTTAGTGCTTTTGG + Intronic
1005020014 6:21408587-21408609 TGTGATAAACCTAATGAATTTGG + Intergenic
1008111870 6:47503952-47503974 TTCCAACAACAAAATGCATTTGG + Intronic
1009779636 6:68253802-68253824 TTCCATAAACATAAGGCAAAGGG - Intergenic
1010064958 6:71671756-71671778 GGCCACAAACATAATGCTGTGGG + Intergenic
1010278231 6:73993417-73993439 TGCCAGCTACATAATGCTTTGGG - Intergenic
1010577864 6:77555166-77555188 AGGCAAAAACATAATGCATGTGG + Intergenic
1011688465 6:89843607-89843629 GGCCATAAGCATCATTCATTGGG + Intronic
1013008226 6:106095086-106095108 TGAAAAAAACATAATGCATTTGG + Intronic
1015359863 6:132327679-132327701 TTCCATAAACACCATGTATTGGG + Intronic
1015666002 6:135629614-135629636 TGCCAAAAATCTAATTCATTAGG + Intergenic
1021003525 7:15363712-15363734 TTACAAAAACATACTGCATTTGG - Intronic
1021016494 7:15541418-15541440 CCACATAAAAATAATGCATTAGG - Intronic
1021247082 7:18276424-18276446 TGACACAAACTGAATGCATTAGG - Intronic
1021396944 7:20161498-20161520 TGCAATAACTATAATGAATTTGG - Intronic
1021536880 7:21715429-21715451 TGCCATTAAGATGATACATTGGG + Intronic
1021706958 7:23377080-23377102 TGTCATAAACATTATGTAATTGG - Intronic
1023483080 7:40655926-40655948 TGCCAAAAACATATTGCCTTTGG + Intronic
1026400185 7:70002214-70002236 TGTCATAGACAGAATGCATTTGG + Intronic
1028563521 7:92202604-92202626 TGCCAGAAAGATAATGGGTTAGG + Intronic
1028715390 7:93960344-93960366 TGACATGAACATAAAGCATGTGG + Intergenic
1028720202 7:94021610-94021632 TTCCATATACATAAGGAATTAGG - Intergenic
1031262334 7:119536709-119536731 TGGAATAATCATAATGCTTTGGG + Intergenic
1031289820 7:119919742-119919764 TGAGATACACATAATTCATTGGG - Intergenic
1032623039 7:133557424-133557446 GGCCATTAACAGAATGCATATGG - Intronic
1033252868 7:139776362-139776384 GGCCAGAAACCTAATTCATTTGG + Intronic
1033767810 7:144513884-144513906 TGCCATAAAAAGCATGCCTTTGG - Intronic
1037002181 8:13733220-13733242 TTCCATAACCATTGTGCATTGGG - Intergenic
1037490223 8:19390743-19390765 TGCCATCAACATGATTGATTGGG + Intronic
1040651719 8:49456668-49456690 TGCCATGAACATAAGTAATTGGG + Intergenic
1041578831 8:59433230-59433252 TGCCATTAATATAATGATTTTGG + Intergenic
1042414880 8:68508005-68508027 TGCCAGAAAGATAAGGCCTTAGG - Intronic
1043060738 8:75498897-75498919 TGCCATAAATATACTTTATTTGG - Intronic
1044224789 8:89706406-89706428 TACCATTCACATAATTCATTTGG + Intergenic
1044378722 8:91506268-91506290 AGAAATAAACAAAATGCATTTGG - Intergenic
1045903838 8:107318059-107318081 TGCCAAAAACATGAAGCAATAGG + Intronic
1046174166 8:110553158-110553180 TCCCATAAGCAGAATGCAGTAGG - Intergenic
1049028976 8:140018844-140018866 TGCCAGAAAAATAATGAATACGG + Intronic
1051395177 9:16612725-16612747 AGGCATAAACAAAATGCTTTAGG + Intronic
1052211502 9:25909548-25909570 TGCCATGAGGAAAATGCATTAGG - Intergenic
1053745933 9:41197869-41197891 TGCTATAAAAATAAAGCATATGG - Intronic
1054682410 9:68233411-68233433 TGCTATAAAAATAAAGCATATGG + Intronic
1055278229 9:74643596-74643618 TGCCATAAAAATATTGAAGTAGG + Intronic
1055846384 9:80568594-80568616 TACCATAAACATAATGTGATCGG - Intergenic
1058927542 9:109682349-109682371 TGCCTTGTACATAATGCACTAGG + Intronic
1060063344 9:120481277-120481299 TGCCTTAAATATAATGCATCTGG + Intronic
1202782065 9_KI270718v1_random:8642-8664 TGCTATAAAAATAAAGCATATGG - Intergenic
1188473410 X:30565066-30565088 TGCCCTAATCATGATGGATTTGG - Intronic
1188918644 X:35944363-35944385 TGACATAATCATAATTTATTTGG + Intronic
1191839522 X:65501769-65501791 TGCCTGAAAAATAATGCCTTGGG - Exonic
1194019742 X:88672770-88672792 TGCTATAAATATAATTCAATTGG + Intergenic
1196072188 X:111538406-111538428 TCCCATAAATTTAATGAATTAGG + Intergenic
1196274391 X:113750009-113750031 AGACATAAACATAAAGCATTGGG - Intergenic
1196558447 X:117119623-117119645 TCACATAAAAATAATGCAGTAGG - Intergenic
1197397411 X:125943600-125943622 TGCCATAGACATAATGAATCGGG + Intergenic