ID: 1167829592

View in Genome Browser
Species Human (GRCh38)
Location 19:52008487-52008509
Sequence CCTTCTATTCAGCTGCTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167829592_1167829597 18 Left 1167829592 19:52008487-52008509 CCTTTCAGCAGCTGAATAGAAGG No data
Right 1167829597 19:52008528-52008550 TTACACTTTGTACAAAGGTTAGG No data
1167829592_1167829596 13 Left 1167829592 19:52008487-52008509 CCTTTCAGCAGCTGAATAGAAGG No data
Right 1167829596 19:52008523-52008545 GACGTTTACACTTTGTACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167829592 Original CRISPR CCTTCTATTCAGCTGCTGAA AGG (reversed) Intergenic
No off target data available for this crispr