ID: 1167829597

View in Genome Browser
Species Human (GRCh38)
Location 19:52008528-52008550
Sequence TTACACTTTGTACAAAGGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167829592_1167829597 18 Left 1167829592 19:52008487-52008509 CCTTTCAGCAGCTGAATAGAAGG No data
Right 1167829597 19:52008528-52008550 TTACACTTTGTACAAAGGTTAGG No data
1167829591_1167829597 19 Left 1167829591 19:52008486-52008508 CCCTTTCAGCAGCTGAATAGAAG No data
Right 1167829597 19:52008528-52008550 TTACACTTTGTACAAAGGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167829597 Original CRISPR TTACACTTTGTACAAAGGTT AGG Intergenic
No off target data available for this crispr