ID: 1167832581

View in Genome Browser
Species Human (GRCh38)
Location 19:52038183-52038205
Sequence GCTGCTTGTTGGAGAAATCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 97}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167832581_1167832583 0 Left 1167832581 19:52038183-52038205 CCACGATTTCTCCAACAAGCAGC 0: 1
1: 0
2: 1
3: 6
4: 97
Right 1167832583 19:52038206-52038228 TTCTATCACTGACCTGTATTTGG 0: 1
1: 0
2: 1
3: 19
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167832581 Original CRISPR GCTGCTTGTTGGAGAAATCG TGG (reversed) Intronic
901044335 1:6386397-6386419 GCTGCTTGATGGGGACATAGGGG - Intronic
901820946 1:11829088-11829110 AATGCTGTTTGGAGAAATCGGGG + Intronic
905037726 1:34929104-34929126 GCTGGTTGTGGGGGAAGTCGTGG - Intronic
905797261 1:40822766-40822788 GCAGCTGGTTGGAGAAAGTGTGG + Intronic
913214034 1:116605299-116605321 TCTGCTTGTTGGGGAAATAAAGG - Intronic
917108266 1:171517593-171517615 GTTGCTTGTTGGAGAGATGGTGG + Exonic
917923564 1:179770726-179770748 GATGCTTCTTGGAGGAAGCGAGG - Intronic
922817260 1:228458714-228458736 ACTGCTCGTTACAGAAATCGGGG + Exonic
923522094 1:234743016-234743038 GAGTCTTGTTGGAGAAAACGGGG + Intergenic
1070168357 10:73914329-73914351 GCTACTTGTTGGGGAAATTCAGG - Intronic
1071298113 10:84237310-84237332 GCTGGTTGCTGGAGAGGTCGAGG + Exonic
1078064312 11:8067970-8067992 GCTGCATGTTGGAGGAAGAGGGG - Intronic
1078355147 11:10627442-10627464 GCTGCTGGTTGGAGACAAGGGGG - Intronic
1078854705 11:15197602-15197624 GCTGCTTCTGGGAGAAAATGTGG + Intronic
1083640734 11:64144043-64144065 GCTGCTAGGTGGAAAAATGGGGG - Intronic
1087928636 11:103949876-103949898 GTTGCTTCTTGCAGAAAACGCGG + Intronic
1088515325 11:110626352-110626374 GTTGCTTGTTTTGGAAATCGGGG - Intronic
1088672053 11:112151672-112151694 GCAGCTTGATGGTGAAATGGAGG - Intronic
1089973096 11:122710334-122710356 GCTGGTGGTTGGAGAGATGGTGG + Intronic
1091096635 11:132828917-132828939 GCTGCTGAGTGGAGAAAACGAGG - Intronic
1092974788 12:13734242-13734264 GCAGCTTGTTATAGAAATCTAGG + Intronic
1094110210 12:26854175-26854197 GCTTCTGGTTGGAGAGATCAAGG - Intergenic
1095957527 12:47815175-47815197 CCTCCTTTTTGGAGAAATCCTGG - Intronic
1100812936 12:98357671-98357693 GCTACTTGTTGGAAAGATCATGG + Intergenic
1104191236 12:126483575-126483597 GCAGCTTGGTGGAAAAATAGAGG - Intergenic
1106193188 13:27472164-27472186 TCTGCTTTTTGGAGAAATGAGGG + Intergenic
1115852290 14:37598186-37598208 GCTGCTCGTTGGAGGAAACCAGG + Intronic
1120666657 14:87314453-87314475 ACTGCTGGCTGGAGAAATGGAGG - Intergenic
1121434445 14:93909932-93909954 GCTGCTTGCTGCAGAAATTGTGG + Intergenic
1122886974 14:104714501-104714523 GCTGGTTGCTGGAGAACTTGAGG - Exonic
1124158936 15:27252140-27252162 GGTGATTGTTTGTGAAATCGGGG + Intronic
1126994993 15:54432366-54432388 CCTGCTTGTTTGTGAAATCTTGG - Intronic
1128757109 15:70190558-70190580 GCTGCTGTTTGGAGCCATCGAGG - Intergenic
1129909012 15:79210758-79210780 GCTGCTTGTTGGAGTCACCTGGG + Intergenic
1130918977 15:88328301-88328323 GCTGCTTGTTGGATAAATGCAGG - Intergenic
1132736191 16:1387307-1387329 GCTGCTTGCTGGAGAACATGAGG - Intronic
1136054756 16:27680162-27680184 GCTGCATGCTGGAGAAGTGGAGG - Intronic
1136469467 16:30469698-30469720 GGTGCTTGCTGGGGAAATGGAGG - Intergenic
1136525175 16:30825112-30825134 GTTTCTGGTTGGAGAAATCAGGG - Intergenic
1141699311 16:85635188-85635210 GCTGCTCGTTGGAGAATGGGGGG + Intronic
1143542887 17:7580116-7580138 GTTGCTTGTTGGATGAACCGTGG - Exonic
1146941136 17:36845266-36845288 GCTTCTTGCTGGGGAAATCGAGG - Intergenic
1147435264 17:40408877-40408899 GCTACTTGTTGGAGATATAGTGG + Intronic
1148974560 17:51515755-51515777 GGTTCTTGGTGGAGAAATGGTGG - Intergenic
1150757479 17:67928395-67928417 ACTGCTTGTTGGGGAAGTAGTGG - Exonic
1157395170 18:47335359-47335381 ACTGCCTGTTGGGGAAATGGGGG + Intergenic
1157796775 18:50582091-50582113 GCTGCTTGTTGGAGCAACTCAGG + Intronic
1157850420 18:51043633-51043655 GCTGTTTGTTTAAGAAAGCGAGG + Intronic
1158304529 18:56090135-56090157 GGTGGTAGTTGGAGAAATTGAGG - Intergenic
1158789136 18:60754533-60754555 GCTGATTGTTAGAGAGATTGTGG - Intergenic
1162926618 19:13933412-13933434 GCTGGTTGTGGGAGAGATCCAGG + Exonic
1163062445 19:14770238-14770260 ACTGCTTGTTGGAAAAAGCCTGG + Intronic
1163814063 19:19453051-19453073 GCTGATTGCTGGAGGAATGGGGG - Intronic
1167832581 19:52038183-52038205 GCTGCTTGTTGGAGAAATCGTGG - Intronic
934297069 2:91750834-91750856 TCTGCTTGTTGGGGAAATAAAGG + Intergenic
934851385 2:97703714-97703736 GCTGGTTGCTGGAGAAAGTGGGG - Intergenic
937111044 2:119367329-119367351 GGTGCTTGATGGAGAGATGGGGG + Intronic
937536113 2:122889639-122889661 TCTGCTTGTGGGAGAACTTGAGG - Intergenic
944564902 2:200980028-200980050 GGTCCTTGTAGGAGAAATCAAGG + Exonic
1179582182 21:42351032-42351054 TCTGCTTGTTGGACAAACAGAGG - Exonic
1182001201 22:26921257-26921279 GCTGCTTGTTGAAAAAAGCCGGG + Intergenic
1182233711 22:28859236-28859258 GCTGCGTGAAGGAGAAATGGGGG - Intergenic
1183034483 22:35130919-35130941 GCTGTTTGTTGGAGACAATGGGG + Intergenic
1184087738 22:42275306-42275328 GCTGCTTGTTGGGCAGACCGTGG - Intronic
949903742 3:8840966-8840988 GCTGCTTGTGGGAGTAAGCAGGG + Intronic
959830186 3:110852271-110852293 GCTGCTTGTTGCAGTGATCCAGG + Intergenic
961470388 3:127107632-127107654 GCTGTTTGTGGGAGAAAATGGGG + Intergenic
962876432 3:139539269-139539291 GCTGCAGATTGGAGAATTCGGGG - Intronic
965584298 3:170302292-170302314 ACTTCTAGTTGGAGAAATCAAGG - Intronic
967825867 3:193876970-193876992 TCTGCTTGTTGCAGAAACCCAGG - Intergenic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
973771195 4:54208648-54208670 GGTGCTTTTTGGAGACATGGAGG + Intronic
973841564 4:54866418-54866440 GCTGGTTAATGGAGAAATAGGGG - Intergenic
976226059 4:82796756-82796778 GGAGCTTGTTGGAGAACTCTGGG + Intronic
976569795 4:86594662-86594684 GCCGCTTGTGGGAGAAGTGGTGG + Exonic
977350050 4:95872616-95872638 GCTGCATCTTGGAGCAATAGAGG + Intergenic
981610255 4:146586262-146586284 GCTATTTGTTTGAGAAATCAGGG + Intergenic
981821782 4:148895511-148895533 GCTATTTGTTGGACAAATTGAGG + Intergenic
984640379 4:182158439-182158461 GCTGCCTCATGGAGAAATCCAGG + Intronic
993278987 5:85900338-85900360 GCTGCTTTTTGGAGCAAATGGGG - Intergenic
997823694 5:137087900-137087922 GCTCTTTGTTGCAGAAATCCTGG - Intronic
998397339 5:141827137-141827159 CCTGCTGGTTGGAGACATTGAGG + Intergenic
999478301 5:151922095-151922117 TCACCTTGTTGGGGAAATCGGGG - Intronic
1001700450 5:173702857-173702879 TCTGCTTTTTGGAGAAAGAGGGG + Intergenic
1004091529 6:12507622-12507644 GGTGGATGTTGGGGAAATCGAGG + Intergenic
1004602602 6:17164663-17164685 GCTGCTTGTCTGAGAAAAAGAGG + Intergenic
1008802363 6:55384841-55384863 GCTGCTTTTTGGAGAAATCTAGG - Intronic
1010793132 6:80088080-80088102 TCTGGTTGTTGGATAAATTGGGG + Intergenic
1013275624 6:108582219-108582241 GCTGCTTTTAGGTGAAATCTAGG + Intronic
1014343824 6:120241779-120241801 GATGCTTGCTGGAGAAAACTTGG - Intergenic
1017831896 6:158138118-158138140 GCTGCTTGGTGCAGAATTCTTGG - Intronic
1021389864 7:20078949-20078971 GCTGCTAGTGGGAGGAATGGTGG + Intergenic
1024637734 7:51304156-51304178 CCTGCATGATGGAGGAATCGTGG + Intronic
1031820610 7:126496755-126496777 GATGGTTGTAGGAGAAATTGGGG + Intronic
1033258657 7:139823286-139823308 GCTCCTTGTTGGAGAGATGTGGG + Intronic
1037290239 8:17342592-17342614 GCTCCTTGTTGGAGAAGGTGGGG + Intronic
1040529889 8:48258059-48258081 GCTGCCTGAAGAAGAAATCGTGG + Intergenic
1050720946 9:8588773-8588795 GCTGGTTGATGAAGAAATTGAGG - Intronic
1051819224 9:21145105-21145127 GCTGCTTGTTCTAGTAATTGGGG - Intergenic
1055290472 9:74777787-74777809 GCTGCTTTTTGGAGATATACTGG - Intronic
1060559380 9:124530229-124530251 GCTGCCTGTTGGAGGAATTTTGG - Intronic
1060954955 9:127632087-127632109 GCTGTTTGTTGGGGAACTCCCGG + Intronic
1061460994 9:130738688-130738710 GCTGATTGATGGACAAATCATGG + Intronic
1062409658 9:136416883-136416905 GCTGCTTGTTGGAGGAAGCCTGG + Intronic
1201696205 Y:16829216-16829238 CCTGGTTGTTGCAGAAATAGTGG - Intergenic