ID: 1167838591

View in Genome Browser
Species Human (GRCh38)
Location 19:52095564-52095586
Sequence CTCCTACTTACTTGGGACGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 147}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167838588_1167838591 -6 Left 1167838588 19:52095547-52095569 CCGAAAGGGAAGCAATTCTCCTA 0: 1
1: 0
2: 0
3: 30
4: 521
Right 1167838591 19:52095564-52095586 CTCCTACTTACTTGGGACGAAGG 0: 1
1: 0
2: 0
3: 6
4: 147
1167838585_1167838591 12 Left 1167838585 19:52095529-52095551 CCTCAGAGAGATTTTAAACCGAA 0: 1
1: 0
2: 2
3: 18
4: 158
Right 1167838591 19:52095564-52095586 CTCCTACTTACTTGGGACGAAGG 0: 1
1: 0
2: 0
3: 6
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167838591 Original CRISPR CTCCTACTTACTTGGGACGA AGG Intronic
900162574 1:1231496-1231518 ATCCTACTAACTGGGGATGAGGG + Intronic
905373826 1:37504178-37504200 CTCCTACTGCCTTGTGAAGAAGG + Intronic
907520218 1:55018983-55019005 CTCCTAACTAGCTGGGACGATGG + Intergenic
910524328 1:88160442-88160464 TTCCAACTTACTTTGGAAGAGGG + Intergenic
911020562 1:93383003-93383025 CTCCTACCTACTTGTGAGGTTGG + Intergenic
911861154 1:102950961-102950983 TTCCTGCTTACTTGTGAAGAAGG + Intronic
912339503 1:108898027-108898049 CTCCTACATCCTGGGGACCAGGG - Exonic
912394634 1:109332456-109332478 CACCTAGCTACTTGGGACGTGGG + Intronic
915392497 1:155556921-155556943 ATCCCAGTTACTTGGGACAATGG + Intronic
918206697 1:182315854-182315876 GTCCCACCTACTTGGGAGGATGG - Intergenic
919301146 1:195768001-195768023 CTCCTACTGCCTTGTGAAGACGG + Intergenic
919703901 1:200658062-200658084 CTGCTACTTACTGGGGCCCATGG + Intronic
1062793989 10:328840-328862 CTCCTAGTTACTTGGAGCTAAGG + Intronic
1065004388 10:21366144-21366166 CTCCTAGATAGTTGGGACCATGG - Intergenic
1065560899 10:26962623-26962645 CTCCTAAGTACCTGGGACTATGG - Intergenic
1069677860 10:70261279-70261301 CTCCTGCTGACTTGTGAAGAAGG + Intronic
1070532977 10:77353738-77353760 TTCCAACTTAGTTGGGATGATGG - Intronic
1070840724 10:79486121-79486143 GTCCCACTTACTTGGGAGGCTGG + Intergenic
1076507082 10:130985304-130985326 CTCCCAGTTGCCTGGGACGAAGG - Intergenic
1077699163 11:4424003-4424025 CTCCTGCTTTCTTGTGAAGAAGG + Intergenic
1078491341 11:11771995-11772017 CTCCTGCTTATTTGGGACAGTGG + Intergenic
1085817244 11:79752230-79752252 CTCCTACTGCCTTGTGAAGAAGG + Intergenic
1086049899 11:82577548-82577570 CTCCTCCTTACTGGGGAAGCGGG + Intergenic
1089635168 11:119807412-119807434 GTCCGATTTGCTTGGGACGAAGG - Intergenic
1091429740 12:423617-423639 CTCCCAGTTAGTTGGGACCATGG + Intronic
1091860259 12:3774952-3774974 CTCCTGCTGACTTGTGAAGAAGG + Intergenic
1092451479 12:8606368-8606390 CTCCTACTCACATGGGTCGTAGG - Intronic
1093766826 12:22973387-22973409 CTCCTACTGGCTTGGGACATTGG - Intergenic
1094601151 12:31910030-31910052 CTGCTACTTACTTGTTACTATGG + Intergenic
1097081546 12:56434918-56434940 CTCCTACCTACTCGGGAGGCCGG + Intronic
1098694063 12:73529005-73529027 TTCCTGCTTCCTTGGGAAGAGGG + Intergenic
1099443335 12:82724511-82724533 CTCCTACTGCCTTGTGAAGAAGG + Intronic
1101009818 12:100437989-100438011 CTGCCATTTACTTGGGACGTTGG - Intergenic
1101771418 12:107755215-107755237 CTCCTACGTAGCTGGGACTACGG + Intronic
1103125112 12:118415229-118415251 CTACTACCTACTTGGGAACAAGG - Exonic
1109365770 13:61354637-61354659 CTCCTACTGCCTTGTGAAGAAGG + Intergenic
1112359673 13:98706123-98706145 CTTCTACTTACTTGAGACATTGG + Exonic
1114082836 14:19216415-19216437 ATCCTAGTTACTTGGGAGGGAGG + Intergenic
1114387397 14:22269364-22269386 CTCCTTCCTGCTTGGGACGTGGG - Intergenic
1114661521 14:24348575-24348597 CTCCTAAGTACCTGGGACTACGG + Intergenic
1116485388 14:45442966-45442988 CTCCTACTGCCTTGTGAAGAAGG + Intergenic
1120194323 14:81465966-81465988 CTCCTGCTTTCTTGGGAACAGGG + Intergenic
1125838245 15:42773083-42773105 GTCCTAGTGACTTGGGACGCTGG + Intronic
1126824827 15:52538676-52538698 CTCCTGCTTCCTTGTGAAGAAGG + Intergenic
1131446770 15:92504638-92504660 CTGCTACTTACTTTTGCCGAAGG - Intergenic
1135941871 16:26828800-26828822 CTCCTAGTTACTTGGGAGGCTGG + Intergenic
1137944586 16:52721649-52721671 CTTCTACTTAATTGAGAAGAAGG + Intergenic
1140653411 16:77114064-77114086 TTCCTGCTTACGTGGGAAGATGG + Intergenic
1142067082 16:88068831-88068853 CTCTTCCTTTCTTGGGAAGAAGG + Intronic
1147017551 17:37504493-37504515 CTTCTACTTACTTTGGAGGAGGG - Intronic
1150353758 17:64466088-64466110 CTCCTACCGCCTTGGGAAGAAGG - Intronic
1151343472 17:73486797-73486819 CTCCTACTTCCTGGGGAAGGGGG + Intronic
1151491185 17:74432954-74432976 CTCGTCCCTACTTGGGTCGACGG - Intronic
1153437075 18:5079028-5079050 GTCCTATTTATTTGGGACAAGGG - Intergenic
1156423680 18:36984781-36984803 CTCCTAAGTAGTTGGGACTACGG - Intronic
1156670339 18:39461721-39461743 GTCCTACCTACTTGGGAGGCCGG + Intergenic
1158052699 18:53242442-53242464 CTTCAACTTACTTGGGAAAATGG - Intronic
1159172244 18:64785868-64785890 TTCCTGCTTACTTGTGAAGAAGG + Intergenic
1164931172 19:32177438-32177460 GTCCTAGCTACTTGGGAGGATGG + Intergenic
1165492142 19:36130096-36130118 CTCCTAGCTACTTGGGAGGCTGG - Intergenic
1165800844 19:38548698-38548720 CTCCTGAGTAGTTGGGACGACGG + Intronic
1166206147 19:41270716-41270738 CTCCTAAGTAGTTGGGACTACGG + Intronic
1167567403 19:50265401-50265423 GTCCCAGCTACTTGGGACGAAGG + Intronic
1167838591 19:52095564-52095586 CTCCTACTTACTTGGGACGAAGG + Intronic
1167846786 19:52171325-52171347 ATCAGACTTACTTGGGGCGAAGG + Exonic
1168109953 19:54186745-54186767 CTCCTAATCACCTGGGAAGAGGG - Intronic
1168119243 19:54242467-54242489 CTCATCCTTACTAGGGACAAGGG - Intronic
1168125470 19:54280212-54280234 CTCCTCCTCACTGGGGACAAGGG - Intronic
1168128131 19:54298531-54298553 CTCCTGCTCACTGGGGACAACGG - Intergenic
1168169009 19:54574141-54574163 CTCCTCCTCACTAGGGACAAGGG + Intronic
1168171784 19:54594506-54594528 CTCCTCCTCACTGGGGACAAGGG + Intronic
1168176505 19:54631336-54631358 CTCCTCCTCACTGGGGACAAGGG + Intronic
926287412 2:11500700-11500722 CTGTTACTTACTAGGGAAGATGG + Intergenic
928503201 2:31919703-31919725 GTCCTACCTACTTGGGAGGCTGG + Intronic
931736854 2:65203087-65203109 GTCCTAGTTACTTGGGAGGCTGG + Intergenic
938493740 2:131780204-131780226 ATCCTAGTTACTTGGGAGGGAGG - Intergenic
938578047 2:132621855-132621877 TGCCTTCTTACTTAGGACGAAGG - Intronic
939344827 2:140950600-140950622 GTCCCACTTACTTGGGAGGCTGG - Intronic
940420816 2:153477951-153477973 CTGCTACTTACTTGGAATGCGGG - Exonic
945005624 2:205402509-205402531 CTCATACTTACTTGGGACAGGGG + Intronic
945612062 2:212015648-212015670 CTCCAAATTACTTGGGAGGTGGG - Intronic
1172236091 20:33375973-33375995 GTCGTAGTTACTTGGGACGCTGG - Intronic
1173964731 20:47103579-47103601 CTCCTACTGCCTTGTGAAGAAGG - Intronic
1176614166 21:9014172-9014194 ATCCTAGTTACTTGGGAGGGAGG + Intergenic
1180497943 22:15906254-15906276 ATCCTAGTTACTTGGGAGGGAGG - Intergenic
1180538209 22:16415671-16415693 CTCCTGCTTCCTTGTGAAGAAGG - Intergenic
1182167105 22:28186895-28186917 CTGCTACTTTCTTGGAAAGAAGG - Intronic
1183592473 22:38787981-38788003 CTCCTACTTGCTTGTGCCAAAGG - Intronic
1184821525 22:46912677-46912699 CTCCTGAGTACTTGGGACTACGG + Intronic
952389933 3:32871307-32871329 CTCCTGCTTCCTTCGGACTAAGG - Intronic
952478786 3:33738372-33738394 CTCCAACATACTTTGGACCAGGG - Intergenic
953494869 3:43377416-43377438 CTCCTCCTTGCCTGGGAGGAAGG + Intronic
953796366 3:45989194-45989216 CTCCTCCTTATTTGGGACTGGGG - Intronic
955792752 3:62605506-62605528 CTCCCACTTAATTGGGAGCAAGG - Intronic
957460947 3:80519848-80519870 CTTCTCCTTACTTGGGAAAAAGG + Intergenic
965260795 3:166482479-166482501 CTCCTACCTCCTTGTGAAGAAGG + Intergenic
965809627 3:172578422-172578444 CTCCTGCTTCCTTGTGAAGAAGG + Intergenic
967731742 3:192913277-192913299 CTCCTAGCTACTTGGGAGGCTGG + Intronic
968273728 3:197424139-197424161 ATCCCAGCTACTTGGGACGATGG + Intergenic
970333889 4:15011629-15011651 CTCCTATTTTTTTGGGAAGAGGG - Intronic
971014966 4:22479338-22479360 CTCCTGCTTAGCTGGGACTACGG - Intronic
971499412 4:27302020-27302042 CTCCTACTGCCTTGTGAAGAAGG - Intergenic
974463879 4:62227950-62227972 CTCCCACTTAGGTGGGACTAAGG + Intergenic
976706861 4:88027852-88027874 CTCCTACTGCCTTGTGAAGAAGG + Intronic
979541990 4:121894679-121894701 ATCCTACATACTTGGGAAGATGG - Intronic
983379494 4:166973194-166973216 CTCCCACTGCCTTGGGAAGAAGG + Intronic
983641571 4:169948241-169948263 CTCCTACTTTATGGGGAAGATGG - Intergenic
986567930 5:9134026-9134048 CTCCTGCTGACTTGTGAAGAAGG + Intronic
987049257 5:14135794-14135816 CTCCTACTGCCTTGTGAAGAAGG + Intergenic
988645066 5:33085839-33085861 CTCCTACTGCCTTGTGAGGAAGG - Intergenic
992136527 5:73751654-73751676 CTCCTCCTTCCTTAGGAGGAAGG + Intronic
994496358 5:100517934-100517956 CTTCTACTTACTGGGGAAGAGGG + Intergenic
995651704 5:114376974-114376996 GTCCTAGCTACTTGGGAAGATGG + Intronic
1000316950 5:160101714-160101736 CTCCTAAATACTTTGGACTATGG - Intronic
1002257964 5:177973062-177973084 CTACTACCTACTTGGGAACAAGG - Intergenic
1002324057 5:178394029-178394051 CACCTGCTTCCTTGGGACCAAGG - Intronic
1003701748 6:8473820-8473842 TTCCTACTGACTTGTGAAGAAGG - Intergenic
1004430410 6:15537736-15537758 CTCCTACTGCCTTGTGAAGAAGG + Intronic
1004673960 6:17823583-17823605 ATCCTAGTTACTTGGGAGGCCGG - Intronic
1007258648 6:40546346-40546368 CTCATTCTTCCTTGGGAAGAAGG + Intronic
1009609841 6:65927251-65927273 CTCCTACTGCCTTGAGAAGAAGG - Intergenic
1010302910 6:74282460-74282482 CTCCAACTTACTGGTGACCAAGG - Intergenic
1012952738 6:105536120-105536142 GTCCTACCTACTTGGGAGGCTGG + Intergenic
1014275211 6:119380381-119380403 CTCCTGCTGACTTGTGAAGAAGG - Intergenic
1015785081 6:136914999-136915021 CTCCCAATTACCTGGGACTATGG + Intergenic
1018377052 6:163222832-163222854 CTCTTAATTACTTGGGATGGAGG - Intronic
1018396186 6:163379679-163379701 CTCCTGCTTACTTGAGCTGAGGG - Intergenic
1018570353 6:165203658-165203680 CTCCTGCTGCCTTGGGAAGAGGG - Intergenic
1019037238 6:169072000-169072022 CTCCTGCTGCCTTGTGACGAAGG + Intergenic
1019218046 6:170456167-170456189 CTCCTACGTAGCTGGGACTACGG - Intergenic
1020652138 7:10888799-10888821 CTCCCACTTACTTGGGATTCTGG - Intergenic
1021679832 7:23118952-23118974 GTCCCAGCTACTTGGGACGAGGG + Intronic
1023197997 7:37663309-37663331 CTCCTAAGTACCTGGGACTACGG - Intergenic
1026646087 7:72170105-72170127 GTCCTAGTTACTTGGGAGGGAGG - Intronic
1029725870 7:102404041-102404063 CTCCTGAGTACTTGGGACTATGG - Intronic
1032368375 7:131322504-131322526 CTCCTACTGCCTTGTGAAGAAGG - Intronic
1035045453 7:155962645-155962667 GTACTACTTACTGTGGACGACGG + Exonic
1035220986 7:157406500-157406522 CCCCCACTCACTTGGGAGGAAGG - Intronic
1036203920 8:6791563-6791585 CTCCTGCTTAGCTGGGAAGATGG - Intergenic
1036724125 8:11203970-11203992 CTTCTACTTTCTTTGGAAGAAGG + Intergenic
1040729721 8:50428860-50428882 CTATTACTTCCTTGGGACCAAGG + Intronic
1043259130 8:78175813-78175835 TTCCTACCTACTGGGGACAATGG + Intergenic
1043390836 8:79790274-79790296 CTCCTGCTTCCTTGTGAAGAAGG - Intergenic
1046764413 8:118054247-118054269 ATCCTACTTACTAGGAAAGATGG - Intronic
1050533074 9:6607770-6607792 CCCCTACATAGTTGGGACTACGG + Intronic
1054724316 9:68635000-68635022 CTCCTACTTGCTGGGGACGCAGG + Intergenic
1059743040 9:117171692-117171714 CTCCTACTGCCTTGTGAAGAAGG + Intronic
1061192293 9:129088877-129088899 TGCCTACTTAGTTGGGACTACGG + Intronic
1185873531 X:3683714-3683736 CTCCCAAGTAGTTGGGACGACGG - Intronic
1186951725 X:14633743-14633765 CTCCTGCTTCCTTGTGAAGAAGG - Intronic
1189294917 X:39911136-39911158 CTCCTACTAAATGGGGAGGATGG + Intergenic
1189448222 X:41101462-41101484 CTCCTAAGTACCTGGGACTACGG - Intronic
1190375251 X:49782843-49782865 CTCCTGCTACCTTGGGAAGAAGG + Intergenic
1200790774 Y:7297391-7297413 CTCCCAAGTAGTTGGGACGACGG + Intergenic