ID: 1167843378

View in Genome Browser
Species Human (GRCh38)
Location 19:52139996-52140018
Sequence AGCCGCGACCAGCAAGGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 88}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167843372_1167843378 -2 Left 1167843372 19:52139975-52139997 CCAGGGGGCGGGGCCTGGGCGAG 0: 1
1: 1
2: 17
3: 91
4: 710
Right 1167843378 19:52139996-52140018 AGCCGCGACCAGCAAGGGGCGGG 0: 1
1: 0
2: 0
3: 12
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167843378 Original CRISPR AGCCGCGACCAGCAAGGGGC GGG Intergenic
900178782 1:1302388-1302410 AGCCGGGAGCACCCAGGGGCTGG + Intronic
900326954 1:2113056-2113078 AGCCTCGGCCAGCAGTGGGCAGG - Intronic
906949602 1:50323552-50323574 TGCCGTAGCCAGCAAGGGGCTGG - Intergenic
907341576 1:53739263-53739285 GGCCGCGGCCAGCCAGTGGCTGG - Intergenic
917684156 1:177398937-177398959 AGCTGGAATCAGCAAGGGGCAGG + Intergenic
920174420 1:204091259-204091281 AGCCGTGAGCAGCATGGGTCAGG - Intronic
1065585337 10:27212051-27212073 AACAGAGGCCAGCAAGGGGCCGG + Intronic
1069776495 10:70930232-70930254 GGCTGGGACCAGCACGGGGCTGG - Intergenic
1071523349 10:86344502-86344524 AGCAGGGACCAGCAAGAGCCAGG + Intronic
1073330077 10:102664515-102664537 CGCCTGGACCAGGAAGGGGCTGG + Intergenic
1075641270 10:124066249-124066271 AGCGTCGACCAGCTAGGGGAAGG + Intronic
1078761829 11:14257909-14257931 AACCCAGACCAGCCAGGGGCTGG + Intronic
1080647563 11:34197893-34197915 AGCCTCTACCAGCCAGGGCCAGG + Intronic
1083619579 11:64042295-64042317 AGCTGCCACGAGGAAGGGGCTGG + Intronic
1083680516 11:64349593-64349615 GGCGGCGACCAGCAAGGAGGAGG + Exonic
1083997921 11:66281199-66281221 AGGCCAGACCAGCAAGGGGACGG - Intronic
1084169620 11:67394437-67394459 AGCAGTGACCAGCATGGAGCAGG - Intronic
1084192533 11:67505404-67505426 AGCCGGGCCCAGGAAGGGGGCGG - Intronic
1087925068 11:103910477-103910499 AGCCGCGAAGTGCAAGGGGGTGG + Intronic
1088176465 11:107058073-107058095 AGCCCCAACCTCCAAGGGGCTGG - Intergenic
1089815154 11:121166290-121166312 AGCTGCCACCAGCAAGGTGGGGG + Intronic
1092491474 12:8949552-8949574 AGACGGGGCCAGCTAGGGGCCGG + Exonic
1096589410 12:52647698-52647720 AGCCCTGTCCAGCGAGGGGCGGG - Intronic
1102642486 12:114379259-114379281 AACGGCGACCAGCAAAGGCCTGG + Intronic
1102822366 12:115918573-115918595 ACCCGTGAACAGCAAAGGGCAGG + Intergenic
1107987197 13:45785765-45785787 AGCAGCTACCATCCAGGGGCAGG - Intronic
1108576765 13:51797678-51797700 AGCCTCGGCCAGCAGGGAGCTGG - Intronic
1115392278 14:32866671-32866693 AGCCCTATCCAGCAAGGGGCAGG + Intergenic
1116872768 14:50083866-50083888 GGCCACGGCCACCAAGGGGCTGG + Exonic
1119726342 14:76924077-76924099 AGCCAGGACCAGCAAGGGACTGG + Intergenic
1122635216 14:103126652-103126674 AGCCGGGTCCAGGCAGGGGCTGG + Exonic
1125759099 15:42084992-42085014 AGCAGGGACAAGGAAGGGGCAGG - Intronic
1126112639 15:45184828-45184850 AGCCGCGCCCTGCAACGGGCAGG - Intronic
1127965220 15:63918156-63918178 AGCCACCTCCAGCAAGGGCCGGG + Intronic
1128388487 15:67166980-67167002 AACCGCGATGTGCAAGGGGCAGG + Intronic
1128684927 15:69676937-69676959 AGCCAGGAGCAGCAATGGGCTGG + Intergenic
1132958049 16:2606807-2606829 AGCCACGCACATCAAGGGGCTGG + Intergenic
1132970523 16:2686055-2686077 AGCCACGCACATCAAGGGGCTGG + Intronic
1142622427 17:1173392-1173414 ACCCGCCACCACCAAGGGCCTGG + Intronic
1145241343 17:21242483-21242505 GGCCAAGGCCAGCAAGGGGCGGG + Exonic
1146199945 17:30848325-30848347 AGCCGTGACCTCCAAGGGTCAGG + Intronic
1148547412 17:48528785-48528807 AGCCACAACCAGGAAGGTGCAGG - Exonic
1152644120 17:81460990-81461012 GGCAGCGGCCAGCAAGGGGCCGG + Exonic
1154196534 18:12271407-12271429 AGCCGGGAAAAGCGAGGGGCCGG + Intronic
1160910070 19:1470131-1470153 GGCTGCGACCACCATGGGGCTGG - Exonic
1161585708 19:5104232-5104254 ACCCGGGAGCAGAAAGGGGCAGG - Intronic
1161975941 19:7607785-7607807 AGCAGCCATCAGCAAGGGGGAGG - Intronic
1162777014 19:12985949-12985971 AGCTGGGACCAGCAGGGGGTGGG + Intergenic
1167843378 19:52139996-52140018 AGCCGCGACCAGCAAGGGGCGGG + Intergenic
925337295 2:3107814-3107836 AGCCGCCCCCACCAAGTGGCTGG + Intergenic
925844657 2:8024521-8024543 AGCTGCACCCAGCATGGGGCTGG - Intergenic
930026875 2:47034412-47034434 AGGCCCGACCAGGGAGGGGCAGG + Intronic
934027943 2:88016787-88016809 AGGCGTGGCCACCAAGGGGCCGG + Intergenic
937480252 2:122250987-122251009 AGCCACAAGCAGCAAGGGACAGG - Intergenic
943589816 2:189784042-189784064 GGCCGCGAGAAGGAAGGGGCGGG - Intronic
944025588 2:195162494-195162516 AGCCGCTACCAGCTCTGGGCTGG - Intergenic
945891445 2:215435706-215435728 AGCCTCGAAGAGCAAGAGGCAGG - Exonic
947596069 2:231412452-231412474 CCCCGCGAGGAGCAAGGGGCTGG + Intergenic
948003413 2:234587572-234587594 AGCTGCCATCAGCATGGGGCAGG - Intergenic
948384983 2:237575638-237575660 AGCCAGGACCAGGGAGGGGCGGG + Intronic
1172658320 20:36550018-36550040 AGCTGAGACCAGCAGGGGACAGG + Exonic
1172913707 20:38428718-38428740 AGCAGCGTCCAGCAAGCAGCTGG + Intergenic
1175864006 20:62164974-62164996 GGCCTCAGCCAGCAAGGGGCAGG + Intronic
1175877408 20:62236946-62236968 TGCCGGGACCAGGAAGGAGCTGG - Intronic
1175931516 20:62495993-62496015 AGACGCCAGCAGCCAGGGGCTGG - Intergenic
1175985323 20:62761547-62761569 GGCCGGGACCAGCCAGGAGCTGG + Exonic
1176029922 20:63006938-63006960 AGCCGCGACGCGCAGGGGGCGGG + Exonic
1178441650 21:32603355-32603377 AGCCCCTCCCAGCAGGGGGCAGG + Intronic
1179729909 21:43361937-43361959 AGCCGAGAACAGGATGGGGCGGG + Intergenic
1182294713 22:29306304-29306326 AGCCGGCAGCAGCAGGGGGCAGG + Intergenic
1183050585 22:35257729-35257751 AGCCGCCCCCAGGAAGGGGCTGG + Intronic
1184194135 22:42915338-42915360 AGGAGCAACCAGCAAGGGGAAGG + Intronic
949819100 3:8095877-8095899 GGCCCTGACCAGCAATGGGCTGG + Intergenic
954681973 3:52350745-52350767 GGCCGGGACCAGCCAGGGCCAGG + Intronic
954683869 3:52360111-52360133 AGCAGCTGCCAGGAAGGGGCAGG + Intronic
968512100 4:1000304-1000326 AGTCGCGAGCAGCAGGGGCCAGG - Intronic
979674778 4:123398682-123398704 AGCCGCGGCCCCCAGGGGGCAGG - Intronic
985681212 5:1256881-1256903 AGGCGCGGCCAGCACGGGCCAGG + Intronic
990228026 5:53678500-53678522 AGCTGAGAAGAGCAAGGGGCTGG + Intronic
1001097353 5:168786137-168786159 AGCCAAGAGCAGCCAGGGGCTGG + Intronic
1001565412 5:172696592-172696614 AACCAAGACAAGCAAGGGGCGGG - Intergenic
1005475615 6:26204749-26204771 CCCCGCGACGAGCAAGGCGCCGG - Exonic
1005484327 6:26285373-26285395 CGCCGCGACGAGCAAGGCGCCGG + Exonic
1005643990 6:27824229-27824251 CGCCGCGGCGAGCAAGGCGCCGG - Exonic
1005645207 6:27831401-27831423 CGCCGCGGCGAGCAAGGCGCCGG + Exonic
1006581323 6:35079336-35079358 AGCCGAGACCAGCAAGTGATAGG + Intronic
1008931601 6:56946152-56946174 AGCCAGGGCCAGAAAGGGGCAGG + Intronic
1018920352 6:168168129-168168151 AGCAGCCAGCAGCAAGGGGCGGG + Intergenic
1019464810 7:1181743-1181765 AGCCACGATCAGGAAGAGGCAGG + Intergenic
1026100608 7:67381543-67381565 AGCAGGCACCAGAAAGGGGCAGG - Intergenic
1029054925 7:97732203-97732225 AGCCGCGGCCAGCACCGCGCGGG - Intronic
1030593811 7:111511814-111511836 AGCAGGGCCCAGCAAGGAGCTGG + Intronic
1037835304 8:22211918-22211940 AACCCCCACCAGCAAGGGGCTGG + Exonic
1042892931 8:73633399-73633421 AGACAGGACCAGCAAGGGCCAGG + Intronic
1049049823 8:140185676-140185698 AGCCTCCACCAGCGAGGGGCGGG + Intronic
1057358022 9:94347659-94347681 AGCCGCGGCGAGCAAGGAGCTGG + Intergenic
1057649727 9:96909958-96909980 AGCCGCGGCGAGCAAGGAGCTGG - Intronic
1061719524 9:132543076-132543098 AGCGGCAGCCAGCAAGGTGCAGG - Intronic
1062732831 9:138119235-138119257 AGGCGAGCCCAGCAAGGAGCTGG - Intronic
1203773432 EBV:60615-60637 ACCCGAGACCAGAAAGCGGCGGG + Intergenic
1188408876 X:29846327-29846349 AGCAGGGACCAGCAAGGGGACGG - Intronic