ID: 1167843417

View in Genome Browser
Species Human (GRCh38)
Location 19:52140106-52140128
Sequence CGGAGCCGCGGCGGAGGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 235}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167843402_1167843417 18 Left 1167843402 19:52140065-52140087 CCGGGCCGGAGCGGCAGTGGGCG 0: 1
1: 0
2: 1
3: 13
4: 224
Right 1167843417 19:52140106-52140128 CGGAGCCGCGGCGGAGGATGGGG 0: 1
1: 0
2: 3
3: 20
4: 235
1167843404_1167843417 13 Left 1167843404 19:52140070-52140092 CCGGAGCGGCAGTGGGCGTGGCT 0: 1
1: 0
2: 1
3: 7
4: 134
Right 1167843417 19:52140106-52140128 CGGAGCCGCGGCGGAGGATGGGG 0: 1
1: 0
2: 3
3: 20
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167843417 Original CRISPR CGGAGCCGCGGCGGAGGATG GGG Intergenic
900162054 1:1228491-1228513 CGGAGCCGCGGCGGAGCCGGAGG - Exonic
900401773 1:2475688-2475710 CCGAGCTGTGGCGGAGGAGGTGG - Intronic
900600645 1:3501387-3501409 TGGAGCCACGGCCGAGGAGGTGG + Intronic
901045469 1:6393307-6393329 GGGGGCTGCGGCGGCGGATGCGG + Intronic
902366207 1:15975923-15975945 GGGAGCCGGGGCGGAGGCGGCGG - Intronic
903069102 1:20717828-20717850 CGGGGCCGCGGCGGGGGGCGGGG + Exonic
903926427 1:26833957-26833979 CGCAGGCGTGGCTGAGGATGGGG - Intronic
905212688 1:36385564-36385586 CAGAGCCCCAGCGGAGGAGGGGG + Intronic
905212801 1:36385944-36385966 CGGGGCCGCGGCTAAGGCTGGGG - Intergenic
905648299 1:39639746-39639768 CGGAGCTGCGGCGCAGGAAAGGG - Exonic
906531532 1:46526666-46526688 AGGAGCTGGGGCGGAGGATGGGG - Intergenic
906591022 1:47024026-47024048 GGGAGGGGCGGAGGAGGATGCGG + Intronic
910221466 1:84893127-84893149 CGGAGAAGCAGCGGAGGACGCGG + Intronic
910449031 1:87328651-87328673 GGGAGCGGCGGCGGACGGTGCGG - Exonic
911527543 1:99004755-99004777 CGGGGGCGCGGCGGCGGAGGCGG + Exonic
912800181 1:112715314-112715336 CGGGGCCGCGGCCGAGGGCGGGG - Exonic
915167861 1:153958538-153958560 CGAGGCCGCGGCGGAGGCCGCGG - Exonic
915517508 1:156421745-156421767 CAGAGCCGCGGCAGAGGCAGAGG - Intronic
917310129 1:173669876-173669898 CGGAACCGCGGCGCAGGAGGAGG - Intergenic
917817530 1:178725585-178725607 CGGAGCTGGGGCTGAGGCTGAGG + Intronic
919712339 1:200739811-200739833 AGGAGCCGCGGTGAAAGATGGGG + Exonic
920216911 1:204367429-204367451 CGCAGCCGCGGGGCAGGATGTGG - Intronic
920352170 1:205344308-205344330 CGGAGCCGCCGCCGGGGAGGAGG + Exonic
921155068 1:212432954-212432976 CCGCGCCGCGGCGGCGGCTGCGG + Exonic
924362359 1:243254978-243255000 AGCAGCCGCGGCGGTGGCTGCGG + Intronic
924775323 1:247111805-247111827 CGGAGGCGCCGGGGAGGGTGTGG + Exonic
1063663653 10:8049719-8049741 AGGGGCCGAGGCGGAGGAGGGGG + Intergenic
1065188661 10:23192182-23192204 CGGAGGCGCGGCGGTGGGCGGGG - Intergenic
1067694368 10:48524247-48524269 CGGGGCCGCGGTGGAGTGTGAGG - Intronic
1070257619 10:74825490-74825512 CGGAGCCGAGGAGGAGGAGGCGG + Intergenic
1070290597 10:75111288-75111310 CGGAGCCGGGGCGGGGCCTGTGG - Intronic
1070835881 10:79446528-79446550 TGGAGCCGGGGTGGAGGAAGAGG - Intergenic
1071695296 10:87863518-87863540 CGGCGCGGCGGCGGAGGGGGCGG + Exonic
1073099116 10:100997859-100997881 TGGAGCCGGGGCGGAGCAGGAGG + Intronic
1073340922 10:102744019-102744041 CGGCGCCGTGGCGGAGGAGCAGG + Exonic
1074182550 10:111077198-111077220 AGGAGCCGCGACGGAGGCAGGGG - Exonic
1074814505 10:117134311-117134333 CGGGGCGGCGGCGGCGGCTGCGG + Exonic
1075885482 10:125896188-125896210 CGGGGCCCCGGCGGCGGAAGGGG - Intronic
1077900129 11:6481143-6481165 CCGAGCCCCGGGGAAGGATGAGG - Intronic
1080802010 11:35618332-35618354 GGGAGCGGAGGCGGAGGAGGGGG + Intergenic
1083430683 11:62612475-62612497 CCGAGCGGCGGCGGCGGAGGAGG + Exonic
1084284068 11:68120695-68120717 CGGGGCCGGGGCGGAGGCCGGGG - Intronic
1084284261 11:68121310-68121332 CGGGGCGGCGGCGGCGGCTGCGG + Intronic
1085561273 11:77474212-77474234 CGGCGCGGCGGCGGCGGCTGCGG + Intronic
1087761816 11:102110671-102110693 AGGCGCCGGGGCGGGGGATGCGG + Exonic
1089500667 11:118929583-118929605 TGGAGCCGCGGAGGGGGAGGAGG - Intronic
1091201893 11:133787562-133787584 CGGAGCCGGGGCCGCTGATGCGG - Intergenic
1091335933 11:134765796-134765818 CGGAGGCATGGGGGAGGATGGGG + Intergenic
1091498416 12:991607-991629 GGGAGCCGAGGCGGTAGATGTGG + Intronic
1096716211 12:53493051-53493073 GGGGGCCGCGGCGGCGGAAGGGG + Intronic
1096777631 12:53973826-53973848 GGGTGCCGAGGCGGAGGCTGAGG + Exonic
1096841035 12:54379248-54379270 CGGAGGCGGGGCCGAGGACGGGG + Intronic
1097157841 12:57025776-57025798 GGGAGCCGGGGCGGGGGGTGCGG + Intronic
1099989876 12:89709737-89709759 GGGAGCGGCGGGGGAGGAGGGGG + Intergenic
1102256527 12:111418574-111418596 CCGAGCGGCGGCGGAAGATGTGG - Exonic
1102278204 12:111598834-111598856 GGGAGCCGTGGCCGAGGACGAGG + Exonic
1103309110 12:119989994-119990016 CGGAGCCCCCGGGGAAGATGAGG - Exonic
1103363937 12:120369117-120369139 CGGAGCGGCGGCGGCGGCGGCGG + Exonic
1104049559 12:125186483-125186505 AGGAGCCGCGGCGGCGGCGGCGG + Intergenic
1105512447 13:21061650-21061672 CGGAGCGGCCGCGGAGGAGCAGG - Intergenic
1107624842 13:42272045-42272067 CGGAGCTGCGGCGGCGGCGGCGG + Intergenic
1108568886 13:51729976-51729998 GGGGGCCGAGGGGGAGGATGGGG - Intronic
1113724314 13:112587431-112587453 CTGCGCCGCGGAGGTGGATGCGG - Intronic
1113928696 13:113954928-113954950 CGGAGACGAGGAGGAGGATCTGG + Intergenic
1113928701 13:113954951-113954973 CGGAGACGAGGAGGAGGATCTGG + Intergenic
1113928706 13:113954974-113954996 CGGAGACGAGGAGGAGGATCTGG + Intergenic
1114318320 14:21526270-21526292 GGGAGCAGCGGCGGAGGGGGAGG + Intronic
1118137409 14:63045210-63045232 AGGATCCGCGGCGGGGGAGGGGG + Exonic
1118992439 14:70809069-70809091 CGGGGCCGAGGAGGAGGAGGAGG - Exonic
1119403222 14:74378476-74378498 CGGAGTCGCGGCCGTGGACGCGG - Intergenic
1119500893 14:75126777-75126799 CGGCGGCGCGGCGGAGCAGGAGG - Exonic
1119649892 14:76376149-76376171 CGAAGCCGTGGAGGAGGCTGGGG - Intronic
1121098426 14:91233738-91233760 CGCAGCCGCGGCAGAGGACACGG + Exonic
1122200730 14:100121080-100121102 AGAAGCCAAGGCGGAGGATGTGG - Intronic
1122486760 14:102087140-102087162 CGCGGCCGCGGCGGCGGCTGGGG - Intronic
1122658472 14:103278998-103279020 CGGAGCCGGGGCGGAGGAGGCGG - Intergenic
1122707351 14:103629532-103629554 CAGGGACGGGGCGGAGGATGAGG - Intronic
1124375855 15:29128260-29128282 CAGAGCCGGGGCGGGGGAGGTGG - Intronic
1124453875 15:29822557-29822579 CGGGGCCGCGGCGGGGGAGGGGG + Intronic
1125516435 15:40323739-40323761 CGGCGGCGTGGCGGCGGATGGGG + Intergenic
1126150825 15:45522557-45522579 CGGAGCCCCGGCGGAGCGTCGGG - Intronic
1126436868 15:48645699-48645721 GGGAGCCGCGGCAGAGACTGTGG - Exonic
1132398311 15:101489801-101489823 GGGAGCCGGGGAGGAGGAGGCGG + Exonic
1132583170 16:694496-694518 CGGGTCCGAGGCGGAGGAGGAGG - Intronic
1133021622 16:2969450-2969472 CCGCGCCGGGGCGGAGGCTGGGG - Exonic
1134798680 16:17064947-17064969 CTGAGCCGAGGCAGGGGATGTGG + Intergenic
1136242154 16:28951206-28951228 CGGTGCCGCGGACGAGGTTGAGG + Exonic
1136399795 16:30011068-30011090 CGGCGCGGCGGCGGGGGACGGGG + Exonic
1136413934 16:30092219-30092241 CTGAGCCCCGGCGGGGCATGGGG - Intergenic
1138619104 16:58197781-58197803 CGGCGGCGCGGCGGGGGACGCGG + Exonic
1139362250 16:66407022-66407044 CGGAGCCGAGCAGGAGGACGAGG - Intergenic
1139484349 16:67247539-67247561 CGGAGGCGGGGCCGAGGAAGGGG + Exonic
1140927764 16:79599916-79599938 CGGAGCGGCGGCGGCGGCGGCGG - Exonic
1141054498 16:80803663-80803685 CGGGGGCGCGGGGGAGGAGGGGG - Intronic
1141839633 16:86566660-86566682 CGGAGTCGCCGCGGAGGCCGGGG + Intergenic
1142228174 16:88887469-88887491 GGGAGCCGGGGCGGTGGGTGGGG + Intronic
1142509656 17:385829-385851 CGGGGACGCGGCGGGGGGTGGGG - Intronic
1142984861 17:3689536-3689558 CGGAGCCCAGTCGGAAGATGGGG + Exonic
1143099804 17:4498857-4498879 CAGAGCCGCGGCGGCGAACGAGG + Exonic
1143500572 17:7336492-7336514 CGGGGCCTGGGCGGAGGATGGGG - Intergenic
1143628010 17:8122024-8122046 TGGAGCCGCGGCGGCTGGTGCGG + Exonic
1144527243 17:16000176-16000198 CGGGGCCGCTGCCGAGGACGGGG + Exonic
1146332333 17:31937413-31937435 CGCTGCCGCCGCGGAGGAGGAGG - Exonic
1146756099 17:35433196-35433218 TGGAGCCGCAGCCCAGGATGGGG - Exonic
1147424879 17:40341761-40341783 CGAAGCCGTGGTGGAGGAGGTGG - Intronic
1148060059 17:44830084-44830106 CCGAGGCCCGGCGGAGGAGGCGG - Intronic
1148437165 17:47693964-47693986 CGGAGCAGCCGGGGAGGAGGAGG + Intergenic
1148648131 17:49230758-49230780 CGGAGCCGCGGCCGGCGCTGCGG + Exonic
1148755767 17:49972239-49972261 CGGTGCCGCCGCGGGGGATCTGG - Intronic
1149712539 17:58756213-58756235 GGTAGCCGCGACGGAGGAGGGGG + Exonic
1151825730 17:76523219-76523241 GGGATCCGCGGCGCAGGAGGCGG + Intergenic
1152069074 17:78126243-78126265 CGGGGCCGAGGCCGAGGCTGAGG + Intronic
1152880137 17:82809735-82809757 CAGAGCCCTGGCGGATGATGTGG + Exonic
1155128155 18:22901326-22901348 CGGAGCGGGGGCGGGGGGTGGGG - Intronic
1156213840 18:34976944-34976966 CGGAGCGGCGGCGGCGGCGGCGG + Intronic
1157473773 18:48008570-48008592 CGGGCCGGCGGCGGAGGAGGAGG - Intergenic
1160724854 19:613566-613588 CGGGGCCGGGGCCGGGGATGGGG + Intronic
1161064176 19:2229405-2229427 AGGAGCCAAGGCGGAGGCTGTGG + Intronic
1162022420 19:7873948-7873970 TGGAGCCGAGGCGGGGGAGGCGG - Intronic
1162118199 19:8445013-8445035 CGAAGCGGCGGCGGAGGTGGCGG + Exonic
1163029815 19:14536979-14537001 CGGGGCCGAGGAGGAGGAGGTGG + Intronic
1165058728 19:33194739-33194761 CGGAGCCGCGGGGCAGGAGGCGG + Exonic
1165236797 19:34428398-34428420 ACGAGCCGCGGCGGAGGCGGAGG - Exonic
1165430091 19:35767415-35767437 GGGAGCCGGGGTGGAGGCTGGGG - Intronic
1166084704 19:40467141-40467163 GGGAGGCGCGGCGGCGCATGCGG + Intronic
1167056054 19:47112319-47112341 CCGGGCCGCGGAGGAGGAGGAGG - Intronic
1167158411 19:47752859-47752881 CTGAGCCGAGGCAGAGGCTGAGG + Intronic
1167843417 19:52140106-52140128 CGGAGCCGCGGCGGAGGATGGGG + Intergenic
1168153591 19:54461506-54461528 CGGTGTGGCGGCGGAGGATCTGG - Exonic
925201262 2:1969202-1969224 CTGGGCCCCGGCGGGGGATGCGG + Intronic
926035109 2:9630467-9630489 CGGGGCCGGGGCGGAGGGCGAGG + Exonic
927652483 2:24920600-24920622 GGAAGCCGCGGCGGAGGAGGGGG - Intergenic
928143577 2:28751841-28751863 CGGTGCCGAGGAGGAGGAGGTGG + Exonic
929701824 2:44169028-44169050 CGAGGCTGCGGCGGAGGAGGTGG + Exonic
930872758 2:56184639-56184661 CGGAGGCGCGGCGGCGGCTGCGG + Exonic
931762746 2:65431891-65431913 GGGGGCCGGGGCTGAGGATGCGG - Intronic
934562407 2:95320132-95320154 CGGAGGCGCGGCTGAGAATGAGG + Intronic
934763842 2:96869739-96869761 GGGAGCCGCGGCGGCGGAGACGG - Intronic
935196644 2:100820240-100820262 CGCAGCCGCGGCGGCGGCGGCGG + Exonic
940215119 2:151296226-151296248 CGGAGGCGCGGGGGAGGCTCAGG - Intergenic
944743670 2:202635353-202635375 CGGAGCGGCGGCGGCGGCGGCGG + Exonic
946327875 2:218993977-218993999 CGGGGGCGCGGCGCAGGATCTGG - Intergenic
947506561 2:230712666-230712688 GGAAGCTGCGGCGGAGGAAGAGG + Intergenic
947741725 2:232487824-232487846 CGGCGCGGCGGCAGAGGAGGCGG - Exonic
948697309 2:239738203-239738225 CGGGGCCGGGGCCGGGGATGGGG - Intergenic
949014491 2:241701878-241701900 CGGGGCCCGGGCGGAGGTTGTGG - Intergenic
1171852109 20:30316291-30316313 CCGATCCGCTCCGGAGGATGGGG + Intergenic
1172618707 20:36306396-36306418 CGGAGCCGGGGCGGGGGCCGGGG + Exonic
1172951216 20:38724499-38724521 CGGAGCGGCGGCGGCGGCGGTGG - Exonic
1173803735 20:45911097-45911119 CGGGGCCTCGGCGGTGGAGGCGG - Intronic
1175429055 20:58889964-58889986 CGAAGCTGCGGCGGCGGCTGCGG + Intronic
1176016802 20:62938116-62938138 GGGGGCCGCGGCGGAGGCGGGGG - Exonic
1176178815 20:63740299-63740321 CGGATCCGCGGCGGAGGTTGAGG + Intronic
1177389165 21:20444028-20444050 CGGGGCCGCGGGGGAGGTCGCGG + Intergenic
1178351003 21:31873247-31873269 CGGCGGCGAGGCGGAGGCTGCGG + Intergenic
1178673909 21:34614960-34614982 CGGGGCCGCGGCGGAGGCGGCGG - Exonic
1180042749 21:45288344-45288366 CGGGGGCGGGGCGGAGGAGGGGG + Intergenic
1180614993 22:17121019-17121041 AGGAGCCCCCGCGGAGGAAGAGG + Exonic
1182297223 22:29316622-29316644 GAGAGCAGAGGCGGAGGATGGGG - Intronic
1182494221 22:30694928-30694950 CCGAGCCGAGGCGGCGGCTGTGG + Exonic
1183410230 22:37650644-37650666 CGGAGCCGGGGTGGTGGCTGGGG - Exonic
1183427063 22:37745907-37745929 TGGCGCGGGGGCGGAGGATGCGG - Intronic
1183437235 22:37803145-37803167 CGGATCTGGGGCGGGGGATGGGG + Intergenic
1183702464 22:39457900-39457922 GGGAGCCGCGCCGGAGGCTGGGG - Intronic
1183702474 22:39457923-39457945 CCGCGCCGCGCCGGAGGTTGTGG - Intronic
1184034290 22:41911172-41911194 CTGAGCGGCGGCGGAGCACGCGG - Intronic
1184089301 22:42283905-42283927 CTGAGCCGAGGCGGGGGAGGAGG + Intronic
1184506540 22:44907179-44907201 CGGAGCAGAGGCGGAGGCTGGGG - Intronic
1184533737 22:45072502-45072524 GGGAGCTGCGGCGGGGGAGGAGG - Intergenic
1184679330 22:46061814-46061836 CGGAGCCGCTGCAGAGGGTCCGG - Intronic
1185414521 22:50702590-50702612 CTGAGCAGAGGCTGAGGATGGGG - Intergenic
949969912 3:9396440-9396462 GGGAGCTGCGGTGGAGGAGGTGG - Intergenic
950479816 3:13237317-13237339 CAGAGCCTCGGAGGATGATGGGG - Intergenic
951551518 3:23879670-23879692 CTGGGCCGCGGCGGAGGACAGGG + Intronic
951907894 3:27721908-27721930 CGCAGCCGCGGCGGCGGCGGCGG + Exonic
953518822 3:43622082-43622104 CGGGGCCGCGGCGGGAGAGGCGG + Intronic
953561189 3:43995155-43995177 CGTAGCGGCCGCGGAGGGTGGGG + Intergenic
953897363 3:46812502-46812524 CGGCGCCACGACGGAGGCTGAGG - Exonic
954620044 3:51990424-51990446 GGGAGCCGAGGCAGAGGAGGCGG - Intergenic
954698242 3:52438843-52438865 CGGAGCAGGGGCAGAGGAGGAGG + Intronic
965590666 3:170357783-170357805 CGGCGACGCGGCGGAGGCGGCGG + Intronic
968701302 4:2059405-2059427 CGGACCCGCGGCGGCGGCGGCGG - Intergenic
968850489 4:3074617-3074639 CGGGGCCGCGCCGGCGGAGGCGG - Intergenic
972503424 4:39698280-39698302 CGTAGCGGTGGCGGAGGAGGCGG + Exonic
975342638 4:73258800-73258822 CGGAGCGGCGGCGGCGGCGGCGG - Intergenic
975633041 4:76421113-76421135 CGGCGCCGCAGCCGAGGAGGAGG - Intronic
977810265 4:101348364-101348386 CGGACTAGCGGAGGAGGATGCGG + Exonic
983296311 4:165873408-165873430 CGGAGCTGCGGCGGCGGCTTTGG + Exonic
985472363 5:53891-53913 CGGAACCGGGGAGGAGGCTGGGG + Intergenic
985504615 5:271850-271872 CGGGGCCGCCGCGGCGGAGGCGG - Intronic
985778161 5:1856226-1856248 CGGAGCCGCGGGGAAGAGTGGGG + Intergenic
986249638 5:6044500-6044522 GGGAGCCGCAGGGGAGGAGGTGG + Intergenic
993386412 5:87268002-87268024 CGGTGCCGCTGCTGAGGCTGGGG - Exonic
996708308 5:126519434-126519456 GGGAGGCGGGGCGGAGGTTGCGG - Intergenic
997965474 5:138352860-138352882 GGGAGCCGAGGCCGAGGCTGAGG - Exonic
998435917 5:142108790-142108812 CGGAGCCTCGGCGGCGGCGGCGG + Exonic
1001948113 5:175797075-175797097 CGGAACCAGGGCGGAGGGTGCGG - Intronic
1002211166 5:177600184-177600206 CGGAGAGGCGGCGGCGCATGGGG - Exonic
1003874140 6:10422086-10422108 CGGAGCTGCGGAGGAGGTCGGGG - Intergenic
1004864279 6:19837868-19837890 CGCAGCCGCGGCGGCGGCGGCGG + Exonic
1006834021 6:36986062-36986084 CGGAGCGGCGGCGGGGGTCGAGG - Exonic
1007781403 6:44256975-44256997 CGGAGCTGCAGCGGAGGGGGCGG - Intronic
1011470367 6:87701955-87701977 GGGAGCCGCGCCTGAGGAGGCGG - Exonic
1016709810 6:147156709-147156731 CTGAGCTGCAGCTGAGGATGGGG - Intergenic
1017672068 6:156778042-156778064 CGCTGCCGCCGCGGAGGAGGAGG - Exonic
1019563792 7:1670082-1670104 CGGACTCGCGGCGGAGGAAGAGG + Intergenic
1019603862 7:1898827-1898849 AGGAGCCGGTGCTGAGGATGTGG + Intronic
1019624076 7:2006969-2006991 CAGAGCCGCGGGAGGGGATGGGG + Intronic
1019689668 7:2403616-2403638 CGGGGCGGCGGCGGCGGCTGCGG + Exonic
1020116340 7:5478465-5478487 AGGAGGCGGGGCGGAGGCTGCGG + Intronic
1021719303 7:23490585-23490607 CGGGGTCGCGGCCGTGGATGGGG + Intergenic
1026592896 7:71712089-71712111 CTGTGCAGCTGCGGAGGATGAGG - Exonic
1026833356 7:73623246-73623268 AGGAGGCGCCGCGGAGGAAGAGG + Intronic
1029506310 7:100965931-100965953 CGGAGCCGGGGCGGAGCATGGGG - Intronic
1031134833 7:117873334-117873356 GGGGGCCGCGGCGGAGGCGGCGG - Exonic
1032091957 7:128915609-128915631 CAGAGCAGCGGAGAAGGATGGGG - Intergenic
1033099980 7:138461137-138461159 CGGAGCAGCGGCGGCGGCGGCGG - Intronic
1035093175 7:156331174-156331196 CGGTGCCGAGGCTGAGGATGGGG + Intergenic
1035677606 8:1466336-1466358 GGCAGCCACGGCTGAGGATGAGG - Intergenic
1035841251 8:2813808-2813830 GGGAGCCCCGGCGGAGGCTGTGG - Intergenic
1035959713 8:4124160-4124182 CGGAGGCGCAGGGGAGGAAGTGG + Intronic
1036755157 8:11466672-11466694 CGGACCCGCGCAGGAGGAGGCGG - Exonic
1036784540 8:11677216-11677238 TGGGGCCGAGGCGGAGGCTGTGG + Intronic
1041839188 8:62249012-62249034 GGCAGCAGCGGCGGAGGACGAGG + Exonic
1042591823 8:70403866-70403888 CGGAGACGCGGAGGAGGAGGAGG - Intergenic
1049867878 8:144950644-144950666 CGGAGCCGCGCGGGGGGTTGTGG - Intronic
1051206327 9:14693143-14693165 CGGAGCGGGGGCCGGGGATGGGG + Intronic
1052763013 9:32611877-32611899 GGGAGCTGGGGGGGAGGATGGGG - Intergenic
1053393698 9:37753693-37753715 CCGAGCCGGAGCGGAGGCTGCGG - Intronic
1053488274 9:38478464-38478486 CGGAGCCACGGAGGATGAGGTGG + Intergenic
1057311508 9:93946063-93946085 CGGAGCTGCCGCGGGGGCTGGGG + Intergenic
1057904778 9:98975123-98975145 CGGAGGCGCGAGGGAGGCTGAGG - Intronic
1060200939 9:121651563-121651585 CGGCCCCGCGGCGGGGGCTGGGG - Intronic
1060263166 9:122093181-122093203 CGGAGCGGCGGCGGCGGCGGCGG - Exonic
1061610030 9:131739997-131740019 CGGAGCGGCGGCGGCGGGCGCGG - Intronic
1062022523 9:134326237-134326259 CGGGGCGGCGGCGGCGGAGGGGG + Intronic
1062442232 9:136575972-136575994 AGGAGCCGAGGCAGAGGCTGAGG + Intergenic
1062450635 9:136614357-136614379 GGGAGCCGGGGCGGAGGGTGGGG - Intergenic
1062453157 9:136623924-136623946 CTGAGCCGGGGAGGAGGGTGTGG - Intergenic
1062507670 9:136886464-136886486 CGGAGCGGCGGCGGCGGCGGCGG + Intronic
1187363689 X:18649972-18649994 CGGGGCGGCGGCGGCGGGTGGGG - Intronic
1192657113 X:73003459-73003481 CGCCGCCGCAGCGGAGGCTGCGG + Intergenic
1192665007 X:73079542-73079564 CGCCGCCGCAGCGGAGGCTGCGG - Intergenic
1196950966 X:120875388-120875410 CGGGCCCGCGACGGAGGAAGAGG - Exonic
1196951796 X:120931760-120931782 CGGGCCCGCGACGGAGGAAGAGG - Exonic
1196952480 X:120936621-120936643 CGGGCCCGCGACGGAGGAAGAGG - Exonic
1196953165 X:120941482-120941504 CGGGCCCGCGACGGAGGAAGAGG - Exonic
1196953850 X:120946342-120946364 CGGGCCCGCGACGGAGGAAGAGG - Exonic
1196954535 X:120951203-120951225 CGGGCCCGCGACGGAGGAAGAGG - Exonic
1196955218 X:120956063-120956085 CGGGCCCGCGACGGAGGAAGAGG - Exonic
1196955905 X:120960946-120960968 CGGGCCCGCGACGGAGGAAGAGG - Exonic
1196956587 X:120965807-120965829 CGGGCCCGCGACGGAGGAAGAGG - Exonic
1196957269 X:120970667-120970689 CGGGCCCGCGACGGAGGAAGAGG - Exonic
1196957951 X:120975527-120975549 CGGGCCCGCGACGGAGGAAGAGG - Exonic
1196958633 X:120980387-120980409 CGGGCCCGCGACGGAGGAAGAGG - Exonic
1196959314 X:120985247-120985269 CGGGCCCGCGACGGAGGAAGAGG - Exonic
1200291706 X:154881584-154881606 CGGAGCGGGGGCGGGGGAGGGGG + Intronic
1200338544 X:155377323-155377345 CGGAGCGGGGGCGGGGGAGGGGG + Intergenic
1200347925 X:155463369-155463391 CGGAGCGGGGGCGGGGGAGGGGG - Intergenic