ID: 1167843612

View in Genome Browser
Species Human (GRCh38)
Location 19:52141685-52141707
Sequence TGGGGACCTAGAATTGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167843612_1167843620 4 Left 1167843612 19:52141685-52141707 CCCTGCACAATTCTAGGTCCCCA No data
Right 1167843620 19:52141712-52141734 ATCCTTGGGTTGACATGCAAGGG No data
1167843612_1167843619 3 Left 1167843612 19:52141685-52141707 CCCTGCACAATTCTAGGTCCCCA No data
Right 1167843619 19:52141711-52141733 AATCCTTGGGTTGACATGCAAGG No data
1167843612_1167843624 23 Left 1167843612 19:52141685-52141707 CCCTGCACAATTCTAGGTCCCCA No data
Right 1167843624 19:52141731-52141753 AGGGAAGAACCCATAGGGAAAGG No data
1167843612_1167843615 -10 Left 1167843612 19:52141685-52141707 CCCTGCACAATTCTAGGTCCCCA No data
Right 1167843615 19:52141698-52141720 TAGGTCCCCAGTGAATCCTTGGG No data
1167843612_1167843623 18 Left 1167843612 19:52141685-52141707 CCCTGCACAATTCTAGGTCCCCA No data
Right 1167843623 19:52141726-52141748 ATGCAAGGGAAGAACCCATAGGG No data
1167843612_1167843622 17 Left 1167843612 19:52141685-52141707 CCCTGCACAATTCTAGGTCCCCA No data
Right 1167843622 19:52141725-52141747 CATGCAAGGGAAGAACCCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167843612 Original CRISPR TGGGGACCTAGAATTGTGCA GGG (reversed) Intergenic
No off target data available for this crispr