ID: 1167843613

View in Genome Browser
Species Human (GRCh38)
Location 19:52141686-52141708
Sequence CTGGGGACCTAGAATTGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167843613_1167843620 3 Left 1167843613 19:52141686-52141708 CCTGCACAATTCTAGGTCCCCAG No data
Right 1167843620 19:52141712-52141734 ATCCTTGGGTTGACATGCAAGGG No data
1167843613_1167843619 2 Left 1167843613 19:52141686-52141708 CCTGCACAATTCTAGGTCCCCAG No data
Right 1167843619 19:52141711-52141733 AATCCTTGGGTTGACATGCAAGG No data
1167843613_1167843624 22 Left 1167843613 19:52141686-52141708 CCTGCACAATTCTAGGTCCCCAG No data
Right 1167843624 19:52141731-52141753 AGGGAAGAACCCATAGGGAAAGG No data
1167843613_1167843623 17 Left 1167843613 19:52141686-52141708 CCTGCACAATTCTAGGTCCCCAG No data
Right 1167843623 19:52141726-52141748 ATGCAAGGGAAGAACCCATAGGG No data
1167843613_1167843622 16 Left 1167843613 19:52141686-52141708 CCTGCACAATTCTAGGTCCCCAG No data
Right 1167843622 19:52141725-52141747 CATGCAAGGGAAGAACCCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167843613 Original CRISPR CTGGGGACCTAGAATTGTGC AGG (reversed) Intergenic
No off target data available for this crispr