ID: 1167843617

View in Genome Browser
Species Human (GRCh38)
Location 19:52141704-52141726
Sequence TGTCAACCCAAGGATTCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167843617_1167843623 -1 Left 1167843617 19:52141704-52141726 CCCAGTGAATCCTTGGGTTGACA No data
Right 1167843623 19:52141726-52141748 ATGCAAGGGAAGAACCCATAGGG No data
1167843617_1167843622 -2 Left 1167843617 19:52141704-52141726 CCCAGTGAATCCTTGGGTTGACA No data
Right 1167843622 19:52141725-52141747 CATGCAAGGGAAGAACCCATAGG No data
1167843617_1167843627 14 Left 1167843617 19:52141704-52141726 CCCAGTGAATCCTTGGGTTGACA No data
Right 1167843627 19:52141741-52141763 CCATAGGGAAAGGAAATCTCTGG No data
1167843617_1167843624 4 Left 1167843617 19:52141704-52141726 CCCAGTGAATCCTTGGGTTGACA No data
Right 1167843624 19:52141731-52141753 AGGGAAGAACCCATAGGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167843617 Original CRISPR TGTCAACCCAAGGATTCACT GGG (reversed) Intergenic
No off target data available for this crispr