ID: 1167843620

View in Genome Browser
Species Human (GRCh38)
Location 19:52141712-52141734
Sequence ATCCTTGGGTTGACATGCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167843612_1167843620 4 Left 1167843612 19:52141685-52141707 CCCTGCACAATTCTAGGTCCCCA No data
Right 1167843620 19:52141712-52141734 ATCCTTGGGTTGACATGCAAGGG No data
1167843610_1167843620 12 Left 1167843610 19:52141677-52141699 CCTAACTGCCCTGCACAATTCTA No data
Right 1167843620 19:52141712-52141734 ATCCTTGGGTTGACATGCAAGGG No data
1167843613_1167843620 3 Left 1167843613 19:52141686-52141708 CCTGCACAATTCTAGGTCCCCAG No data
Right 1167843620 19:52141712-52141734 ATCCTTGGGTTGACATGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167843620 Original CRISPR ATCCTTGGGTTGACATGCAA GGG Intergenic
No off target data available for this crispr