ID: 1167843622

View in Genome Browser
Species Human (GRCh38)
Location 19:52141725-52141747
Sequence CATGCAAGGGAAGAACCCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167843612_1167843622 17 Left 1167843612 19:52141685-52141707 CCCTGCACAATTCTAGGTCCCCA No data
Right 1167843622 19:52141725-52141747 CATGCAAGGGAAGAACCCATAGG No data
1167843618_1167843622 -3 Left 1167843618 19:52141705-52141727 CCAGTGAATCCTTGGGTTGACAT No data
Right 1167843622 19:52141725-52141747 CATGCAAGGGAAGAACCCATAGG No data
1167843613_1167843622 16 Left 1167843613 19:52141686-52141708 CCTGCACAATTCTAGGTCCCCAG No data
Right 1167843622 19:52141725-52141747 CATGCAAGGGAAGAACCCATAGG No data
1167843617_1167843622 -2 Left 1167843617 19:52141704-52141726 CCCAGTGAATCCTTGGGTTGACA No data
Right 1167843622 19:52141725-52141747 CATGCAAGGGAAGAACCCATAGG No data
1167843610_1167843622 25 Left 1167843610 19:52141677-52141699 CCTAACTGCCCTGCACAATTCTA No data
Right 1167843622 19:52141725-52141747 CATGCAAGGGAAGAACCCATAGG No data
1167843616_1167843622 -1 Left 1167843616 19:52141703-52141725 CCCCAGTGAATCCTTGGGTTGAC No data
Right 1167843622 19:52141725-52141747 CATGCAAGGGAAGAACCCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167843622 Original CRISPR CATGCAAGGGAAGAACCCAT AGG Intergenic
No off target data available for this crispr