ID: 1167847359

View in Genome Browser
Species Human (GRCh38)
Location 19:52175514-52175536
Sequence CTAGAGATACAGGTTGGGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167847359_1167847367 11 Left 1167847359 19:52175514-52175536 CCCCGCCCAACCTGTATCTCTAG No data
Right 1167847367 19:52175548-52175570 TCTCTGAGGAGACAGATCTTAGG No data
1167847359_1167847366 -3 Left 1167847359 19:52175514-52175536 CCCCGCCCAACCTGTATCTCTAG No data
Right 1167847366 19:52175534-52175556 TAGAAGGATGATATTCTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167847359 Original CRISPR CTAGAGATACAGGTTGGGCG GGG (reversed) Intergenic
No off target data available for this crispr