ID: 1167850671

View in Genome Browser
Species Human (GRCh38)
Location 19:52199036-52199058
Sequence GGGAAATATACACATGGGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 169}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167850671_1167850678 17 Left 1167850671 19:52199036-52199058 CCTAGCCCATGTGTATATTTCCC 0: 1
1: 0
2: 0
3: 13
4: 169
Right 1167850678 19:52199076-52199098 GAAGAACACACAGATCAACTTGG 0: 1
1: 0
2: 0
3: 16
4: 312

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167850671 Original CRISPR GGGAAATATACACATGGGCT AGG (reversed) Intronic
904287059 1:29459644-29459666 GGGAAGTAGGCACATTGGCTTGG + Intergenic
905488243 1:38322992-38323014 TGGAAAGCTACACAGGGGCTAGG + Intergenic
910683906 1:89896488-89896510 GAGAAATACACACAGTGGCTTGG + Intronic
913317128 1:117562906-117562928 GGGAAATGTCCACAGGGGCCTGG + Intergenic
914666553 1:149837605-149837627 TGGAAAGAAACAAATGGGCTTGG + Intergenic
914669214 1:149856193-149856215 TGGAAAGAAACAAATGGGCTTGG - Intronic
915514157 1:156402941-156402963 GGAATTTATACACATGTGCTTGG + Intergenic
916403753 1:164476535-164476557 GGGAAAAATACATATAAGCTGGG + Intergenic
916948230 1:169751963-169751985 GAGAAATATAAATATGGACTTGG + Intronic
917089620 1:171339792-171339814 GGAAAATAAACAGATGGCCTTGG + Intronic
918099495 1:181361299-181361321 GGGAAATATGGAGGTGGGCTTGG + Intergenic
918528479 1:185490437-185490459 AGGAAATATTCACATGTACTGGG - Intergenic
918531824 1:185531389-185531411 GGAAAATATATACAGGGCCTTGG + Intergenic
919600913 1:199621279-199621301 AGAAAATAAACACCTGGGCTAGG - Intergenic
921032696 1:211347590-211347612 GGGAAATACACACATGGATGGGG + Intronic
921665652 1:217867774-217867796 TGTAAAGATACACATGGGATGGG - Exonic
1064519015 10:16181733-16181755 TGGAAATTTACACATAAGCTCGG - Intergenic
1067748359 10:48953232-48953254 GGGAAAAGGACACAGGGGCTGGG + Intronic
1073723750 10:106206028-106206050 GGGAATTATACACATGAGGCTGG - Intergenic
1076227574 10:128792698-128792720 GGAAAGAACACACATGGGCTGGG - Intergenic
1076232527 10:128833632-128833654 AGGAACTCTATACATGGGCTGGG + Intergenic
1078521657 11:12068596-12068618 TGAAAATGGACACATGGGCTGGG + Intergenic
1080878820 11:36300744-36300766 GGGAAAGCTACATATGGGCCTGG + Intronic
1081685849 11:45042462-45042484 GGTAAAAATACTCAGGGGCTTGG + Intergenic
1082672398 11:56051560-56051582 GGGAATTATACAGATTGGGTTGG - Intergenic
1083225395 11:61281472-61281494 GGGAAAAAAACAGAAGGGCTGGG + Intronic
1085862134 11:80246570-80246592 GGGAAAAATTTACATTGGCTTGG + Intergenic
1087296540 11:96382408-96382430 GAGAAATATTCTCATGGGATTGG + Intronic
1088459128 11:110064242-110064264 GGGAATCATGGACATGGGCTAGG - Intergenic
1088967042 11:114733886-114733908 AGAAAATATACACATGGGACTGG - Intergenic
1089867775 11:121646963-121646985 AGGAAATATATACATGGAATTGG + Intergenic
1093373560 12:18394453-18394475 GGAAAATATAAACATAGCCTGGG + Intronic
1094758468 12:33499422-33499444 GAGAAATATCCATATGGGATAGG - Intergenic
1097928659 12:65160002-65160024 GAAAAATGTACACATGAGCTTGG - Intergenic
1099472298 12:83066355-83066377 GAGAACTATACACATGAACTAGG + Intronic
1100549258 12:95631545-95631567 GAGAAATCTGCACATGGACTAGG + Intergenic
1101484241 12:105136213-105136235 GGGAAATAAAAACAGGAGCTTGG - Intronic
1101876648 12:108600443-108600465 GGGAACTATACCCTTGGCCTTGG - Intergenic
1104834545 12:131779667-131779689 GGGAAAAATACACATGCCTTGGG + Intronic
1106472716 13:30071782-30071804 GGCAAATATACACATAAACTGGG - Intergenic
1106787018 13:33117404-33117426 TAGAAATAAACACATGGGCTGGG - Intronic
1106911881 13:34471796-34471818 GGGAGTAAAACACATGGGCTTGG - Intergenic
1107254577 13:38408589-38408611 GAGAAATATACACTTGGATTTGG + Intergenic
1108061836 13:46540939-46540961 ATGAAATAAACACATAGGCTGGG - Intergenic
1109203820 13:59459863-59459885 GGTAAATACACACCTGGGCCAGG + Intergenic
1113641878 13:111963420-111963442 GGGAAAGAAACACTTGGGCCTGG + Intergenic
1113911366 13:113842970-113842992 GGGAAATAAACAAATGAGTTGGG - Intronic
1114732145 14:25004416-25004438 GAGAATTATACACATGGGGGAGG + Intronic
1117166289 14:53037267-53037289 GGGAAATAAACCCATATGCTGGG + Intronic
1118399643 14:65367811-65367833 AGGGAATAAACACATGGCCTGGG - Intergenic
1119791752 14:77356682-77356704 GAGAAATTTGAACATGGGCTGGG - Intronic
1122401611 14:101470617-101470639 GGGAAAGATACTTCTGGGCTTGG - Intergenic
1125431322 15:39596779-39596801 TGGAAATATGCACAAGGGATGGG - Exonic
1128557313 15:68640647-68640669 GGGAAATTTAAACACGGGCTGGG + Intronic
1131789046 15:95944499-95944521 GGTAAATATGCACATGTGCTAGG + Intergenic
1202963036 15_KI270727v1_random:143320-143342 GGGAGATAAACAGAAGGGCTGGG + Intergenic
1133835460 16:9363524-9363546 GGGTAAGATGCACATAGGCTCGG + Intergenic
1137312599 16:47280505-47280527 GGGAAATATATATTTGGTCTTGG + Intronic
1138690259 16:58760832-58760854 GAAAAATAGACACATAGGCTGGG - Intergenic
1140798495 16:78463190-78463212 AGGAATTATACACTTGAGCTTGG + Intronic
1143851635 17:9817265-9817287 AGGAAAAATCCGCATGGGCTGGG - Intronic
1146476230 17:33164803-33164825 GGGAAATTTAGACATGGGCAAGG - Intronic
1146750093 17:35370834-35370856 GGGAAATATACCCATGTTCATGG + Intronic
1150070817 17:62148398-62148420 GTAAAATACAGACATGGGCTGGG - Intergenic
1152046418 17:77939165-77939187 GGGAACAACACACATGGTCTGGG + Intergenic
1156031034 18:32712648-32712670 GGGAAAAAGAGACATGGGATAGG - Intronic
1156676229 18:39529978-39530000 GGGAAGCATACAGATGGGCAGGG - Intergenic
1159959082 18:74541562-74541584 AGGAAATATGCACATGCGGTTGG + Intronic
1160472493 18:79149785-79149807 AGAAAATAAACACATGGGCCAGG + Intronic
1165344149 19:35233174-35233196 GTCAAATATCCACATGAGCTAGG + Intergenic
1166511382 19:43411444-43411466 GGGAAATAGCCACATGGGCAAGG + Intronic
1167850671 19:52199036-52199058 GGGAAATATACACATGGGCTAGG - Intronic
925036871 2:693708-693730 GGGATATATACAGATGTGCTGGG - Intergenic
927952420 2:27181312-27181334 TGGAAATATACAGATTAGCTGGG - Intergenic
928995973 2:37291638-37291660 GGGAAATATAGAGATGGTTTGGG + Intronic
930872861 2:56185042-56185064 GGAAAAGTTACACAGGGGCTGGG - Intronic
932653535 2:73586053-73586075 AGAAGATATACAAATGGGCTAGG - Intronic
935714147 2:105925124-105925146 GGGAAAGACACAAATGGGCATGG - Intergenic
937041859 2:118828376-118828398 GGGAAACACATACATGGGCTTGG - Intergenic
942042597 2:172080939-172080961 GGGAAAGATACGGAAGGGCTGGG - Exonic
942044570 2:172092480-172092502 TGGAAATCTGCACCTGGGCTGGG + Intergenic
942676632 2:178433781-178433803 AGGAGATATACAAATGGGCTGGG - Intronic
945516555 2:210769375-210769397 GGGAAACATACACTTGTGCAAGG - Intergenic
945892761 2:215447667-215447689 GGGAAACAGACACACGGGCAGGG + Intergenic
946343804 2:219091414-219091436 GGGCAAGAAACACATTGGCTGGG + Intronic
947082407 2:226413136-226413158 GGGAAATATACACATTTTGTGGG - Intergenic
948087281 2:235262139-235262161 GGGAAAAAAACACATGTGTTAGG - Intergenic
1169788687 20:9386846-9386868 GGGAAATATGAATGTGGGCTGGG - Intronic
1169887627 20:10418040-10418062 CAGAAATATAAACATGGCCTTGG + Intronic
1170558957 20:17539405-17539427 CAGAAATATATTCATGGGCTGGG - Intronic
1172394849 20:34594795-34594817 AGAAAATATACATATAGGCTGGG + Intronic
1174503732 20:51003769-51003791 GGGAAACACACATAGGGGCTGGG + Exonic
1179365751 21:40757318-40757340 ACAATATATACACATGGGCTGGG - Intronic
1183543120 22:38441280-38441302 GGGAAATCTCCTCATGGGCTGGG + Intronic
1184172134 22:42765961-42765983 GGAAAATAAACACAAGGGCATGG - Intergenic
949143814 3:670326-670348 TGAAAATAGACAAATGGGCTGGG - Intergenic
949914516 3:8948842-8948864 AGGAAACATACACTTGGGCTGGG + Intronic
950069783 3:10142701-10142723 GGGGAAAATACACGTGGGGTGGG - Intronic
952768408 3:36975704-36975726 GGGAAATCTGAATATGGGCTAGG + Intergenic
954032787 3:47831804-47831826 GAGTAAAATACACATAGGCTGGG - Intronic
954152892 3:48667056-48667078 GGGAAATAAAGACATAGGCCTGG + Intergenic
955897887 3:63720207-63720229 GGTAAATAAACAAATGGGCGTGG - Intergenic
956505916 3:69939891-69939913 GGTAAATATGCAAATAGGCTAGG - Intronic
957675482 3:83358524-83358546 GGAAAAAATTCATATGGGCTTGG + Intergenic
958866671 3:99508851-99508873 GGGAAATAAACAACTGAGCTGGG + Intergenic
959130403 3:102348434-102348456 CAGAAATATATACATGGGGTAGG + Intronic
960305050 3:116050731-116050753 GGGAAATATGCCCTTGGCCTGGG - Intronic
962403675 3:135082253-135082275 TTGAAATAGCCACATGGGCTGGG + Intronic
962411717 3:135146690-135146712 GTGATAGATACAAATGGGCTTGG - Intronic
963252288 3:143114546-143114568 GGGAAGTAGACAGCTGGGCTAGG + Intergenic
963578292 3:147091400-147091422 GGCAAACAGACAAATGGGCTTGG + Intergenic
967194178 3:187012416-187012438 TGGAAATATAAAAATGAGCTGGG - Intronic
969414558 4:7050137-7050159 GGGAAATGCACGCGTGGGCTCGG + Intronic
971537784 4:27775631-27775653 GGGAGATACACACTAGGGCTAGG + Intergenic
972500041 4:39669485-39669507 GGGAAATAAGAACATAGGCTGGG - Intergenic
972888625 4:43526015-43526037 GGGAAATATACACAGGAGAGTGG + Intergenic
974465232 4:62246931-62246953 GGGAAATAAAGACATGAACTTGG - Intergenic
975423539 4:74198397-74198419 GGCTAATATATGCATGGGCTGGG - Intronic
975953634 4:79807913-79807935 GGGAACAACACACATGGGCAGGG - Intergenic
975958896 4:79876977-79876999 GGGAAATATCATCATGGCCTGGG - Intergenic
977444448 4:97111573-97111595 GAGATATAGACACATGGGGTTGG - Intergenic
979685486 4:123506632-123506654 GGGAAAGGTACACATAGGTTTGG + Intergenic
980014506 4:127633225-127633247 AGAGAATATACACGTGGGCTGGG + Intronic
981839840 4:149098649-149098671 GGGAAATTTACAGATAGGCAAGG - Intergenic
983034168 4:162842206-162842228 AGGAAGTCTACAGATGGGCTAGG - Intergenic
983645664 4:169988974-169988996 TGGAAACCTACACATGGGTTTGG + Exonic
984678962 4:182584930-182584952 GGCAAATATACAGCTGGGCACGG - Intronic
985293515 4:188410146-188410168 GGGAAAGTTCCACATGGGCTTGG + Intergenic
987173052 5:15278833-15278855 GTGAAATATACATGTGGGGTAGG + Intergenic
987777218 5:22383675-22383697 GAGAAATATACACATGAATTGGG - Intronic
988713257 5:33799588-33799610 GGGCATTATACCCATTGGCTGGG + Intronic
989606196 5:43246479-43246501 GGAAACTATAAATATGGGCTTGG - Intronic
990257950 5:53991045-53991067 TGGAATTATACCCATGGGGTGGG - Intronic
990647207 5:57858182-57858204 AGAAAATAGCCACATGGGCTGGG + Intergenic
992637206 5:78736196-78736218 AGGGTGTATACACATGGGCTAGG + Intronic
996038690 5:118786824-118786846 GGGAAATCGTCACATGGGATGGG - Intergenic
998013964 5:138717670-138717692 GGGAAAAAAAAAAATGGGCTGGG + Intronic
998370849 5:141660195-141660217 AGAAAATATATACATGGGCCGGG + Intronic
999074743 5:148783625-148783647 TTGAAATATACTCATGGTCTAGG - Intergenic
1000088789 5:157911955-157911977 GAAAAATAAAAACATGGGCTGGG + Intergenic
1005730377 6:28691550-28691572 GGGAGATAGACTCATGAGCTTGG + Intergenic
1007008404 6:38390378-38390400 AAAAAATTTACACATGGGCTAGG - Intronic
1007571563 6:42895080-42895102 GGGAAATAGGCTCATGAGCTTGG - Intergenic
1008014171 6:46499746-46499768 GGCAAAAATAAAAATGGGCTGGG + Intergenic
1010212975 6:73376945-73376967 GAGAAATAAAATCATGGGCTGGG - Intronic
1011083832 6:83516945-83516967 GGGAAATATTCACAGGTCCTGGG + Intronic
1012309688 6:97707371-97707393 GGGAAATATATACATAGCTTTGG + Intergenic
1012349109 6:98229612-98229634 GGGAAATAGAAACATAGGATTGG + Intergenic
1013590618 6:111616816-111616838 TGAAAATATTCATATGGGCTGGG + Intergenic
1017905467 6:158755045-158755067 CGGAAATGGACCCATGGGCTGGG + Intronic
1018717034 6:166541335-166541357 AGGAAACATACACAAGGGCTGGG - Intronic
1020554463 7:9653415-9653437 GGGAAATATAAACGTGCACTTGG + Intergenic
1021469600 7:20986312-20986334 GGGGAATATAGCCATGGCCTGGG - Intergenic
1024149321 7:46553831-46553853 GGGAAAGATACAAATGTGCGTGG + Intergenic
1024612506 7:51079731-51079753 GAGCAATCTGCACATGGGCTGGG + Intronic
1029940245 7:104472715-104472737 GGGAGATATGAACATGGACTTGG - Intronic
1030207016 7:106960988-106961010 GGGAAATATGTATATGGGGTGGG - Intergenic
1032345352 7:131110994-131111016 GGGAAATATACGGACAGGCTTGG + Intronic
1036289498 8:7474969-7474991 TGGAAATATACACAGTTGCTGGG - Intronic
1036331976 8:7836562-7836584 TGGAAATATACACAGTTGCTGGG + Intronic
1036682055 8:10882479-10882501 GGGACAGATGCACATGGGCTGGG - Intergenic
1039956131 8:42208251-42208273 AGGGAATATACACAGGGCCTTGG + Intergenic
1045533580 8:103006478-103006500 GGTAAATATATCCATGTGCTGGG - Intergenic
1047207351 8:122813316-122813338 GGGAAATGGACACATGCTCTTGG - Intronic
1048624910 8:136174504-136174526 GGTAATTACACACAGGGGCTAGG + Intergenic
1048918558 8:139207075-139207097 TGGCAATAGACACATGGGCAGGG + Intergenic
1049810229 8:144564683-144564705 AGGAAAAATACACTGGGGCTGGG + Intronic
1057336430 9:94159250-94159272 TGGAAATGTAAACATGGACTGGG - Intergenic
1058656685 9:107228697-107228719 GGATAATATTCACAAGGGCTTGG - Intergenic
1059748425 9:117225417-117225439 TGAAAATATACAGATGGGCCAGG + Intronic
1061169512 9:128944147-128944169 AGGAAAGATCCACAGGGGCTGGG - Intronic
1061410054 9:130415709-130415731 GGGAAATATGCACCTGTGCAGGG - Intronic
1061934269 9:133848704-133848726 GGGAAAGAAAGCCATGGGCTGGG + Intronic
1187420379 X:19128809-19128831 GGGTAATATACAAATGAGCCTGG - Intergenic
1188038570 X:25345631-25345653 TGAATATATACACATAGGCTTGG + Intergenic
1189269621 X:39741830-39741852 TGGAAATATACTCATGTGTTAGG + Intergenic
1189563084 X:42210823-42210845 GGGAAATAAACACATGAGACAGG - Intergenic
1192329247 X:70161219-70161241 AGGAAATATACAAATAAGCTTGG + Intronic
1193166110 X:78282363-78282385 GGGCAAGATACATATGTGCTAGG - Intronic
1195851353 X:109285287-109285309 GGGAAAATTACACATAGTCTGGG - Intergenic
1196521828 X:116682883-116682905 GGGAAAAATACACATTGGGAGGG - Intergenic
1198186622 X:134259615-134259637 GGGGAATATACACATGAGGCTGG - Intergenic
1198362395 X:135908408-135908430 GGGATATATACATGTGTGCTTGG + Intronic