ID: 1167850760

View in Genome Browser
Species Human (GRCh38)
Location 19:52199773-52199795
Sequence ACACTAACAATCACTGACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 129}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167850760_1167850762 8 Left 1167850760 19:52199773-52199795 CCCAGGTCAGTGATTGTTAGTGT 0: 1
1: 0
2: 0
3: 10
4: 129
Right 1167850762 19:52199804-52199826 TTAGTTTTTTATCTTTCTATAGG 0: 1
1: 0
2: 3
3: 81
4: 1097

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167850760 Original CRISPR ACACTAACAATCACTGACCT GGG (reversed) Intronic
907203709 1:52750646-52750668 ATACTAAAAACCACTGAACTGGG - Intronic
908443071 1:64174267-64174289 ATAATATTAATCACTGACCTTGG - Intronic
908707967 1:66980759-66980781 AGACTAAAAATTCCTGACCTTGG + Intronic
909545486 1:76841938-76841960 ACACTGACAGGCACTGTCCTTGG - Intergenic
916813777 1:168330123-168330145 ACACAAACATACACTTACCTAGG - Intergenic
916925203 1:169512205-169512227 ACACTAACAAGCAATATCCTTGG + Intergenic
917509211 1:175656277-175656299 ACACAAACCAGCAATGACCTCGG + Intronic
918037823 1:180893027-180893049 ACACCAACAATTACTGAACCTGG + Intergenic
919940786 1:202284636-202284658 ACATTTCCAAACACTGACCTAGG - Intronic
921559854 1:216644086-216644108 TCACTAAAACTCTCTGACCTTGG + Intronic
924156537 1:241182445-241182467 ACACTAACATTGACGGAGCTGGG - Intronic
1064087988 10:12359949-12359971 ACACTAACATCCTGTGACCTGGG - Intronic
1073575512 10:104619415-104619437 ACAACAACAATCACAGACCTGGG + Intergenic
1084863885 11:72040498-72040520 ACACACACACACACTGACCTGGG + Intronic
1085476359 11:76791615-76791637 CCACCATCATTCACTGACCTTGG + Intronic
1087923930 11:103898085-103898107 ACTCCAACAATCAATCACCTAGG + Intergenic
1089934864 11:122353771-122353793 ACACTAAAAAGTACTGAGCTTGG + Intergenic
1090096497 11:123746906-123746928 ACACTCACACTCACTTAGCTAGG + Intergenic
1093149392 12:15603402-15603424 ACCCTCACAGTCACAGACCTTGG + Intergenic
1095922033 12:47541401-47541423 CCACTGACAATCACTGGCTTTGG - Intergenic
1099223426 12:79940651-79940673 ACATTTTCAATGACTGACCTCGG - Intergenic
1100997197 12:100314610-100314632 AAACTAACAATAACAAACCTTGG - Exonic
1106100724 13:26693828-26693850 ACACCAAAAATCAAAGACCTGGG + Intergenic
1106760783 13:32865479-32865501 ACACTAGAAATAACAGACCTTGG - Intergenic
1107402617 13:40084224-40084246 ACACTAAGAATCACTTGACTTGG + Intergenic
1111730305 13:92066947-92066969 ACATTTACAAACACTGAGCTAGG + Intronic
1112660979 13:101507289-101507311 ACTCTACCAAGCACTGTCCTTGG - Intronic
1116590726 14:46768759-46768781 ACACTAAAAATAACTGCCCAAGG - Intergenic
1117989470 14:61419625-61419647 ACACTAACAGTCAGGGACCCTGG - Intronic
1123791273 15:23723208-23723230 ACACTAACAATGAATGATCCAGG - Intergenic
1130723576 15:86414743-86414765 ACATTAACGATCACTCAACTTGG + Intronic
1131451304 15:92542399-92542421 AGTCTGAGAATCACTGACCTAGG - Intergenic
1135543191 16:23348071-23348093 ACAGTCACACTCACTCACCTGGG + Intronic
1143971206 17:10797308-10797330 ACACTAAGATTCACTGAACCAGG - Intergenic
1144206777 17:12984962-12984984 ACACTAGCAATCCCTCCCCTAGG - Intronic
1147776556 17:42906076-42906098 ACACTAACAATTATATACCTTGG - Intronic
1151379112 17:73712663-73712685 ACGCTGACACTCACTGACCCAGG - Intergenic
1152231640 17:79116958-79116980 GCACTGAGAACCACTGACCTAGG + Intronic
1155485783 18:26340724-26340746 ACACTGAGAATCATTGATCTAGG + Intronic
1155729668 18:29138342-29138364 ACAGCAACAATCACCGAGCTAGG + Intergenic
1159967114 18:74605846-74605868 ACACTAACACACACAGACGTGGG - Intronic
1162539223 19:11283992-11284014 TCAGAAAGAATCACTGACCTTGG + Intergenic
1167850760 19:52199773-52199795 ACACTAACAATCACTGACCTGGG - Intronic
929060829 2:37923200-37923222 ACAGTGACAACCATTGACCTTGG - Intronic
930469659 2:51795919-51795941 GAACTAACAATCACTGAGTTTGG + Intergenic
930642117 2:53863731-53863753 ACAAAAACAATCAATCACCTAGG + Intergenic
931059761 2:58514385-58514407 ACACTGAGAACCACTGATCTGGG - Intergenic
933298023 2:80512727-80512749 ATACTAAAAAACACTGACATAGG - Intronic
937441034 2:121916343-121916365 ACTCTAACAATCAGTGTTCTGGG - Intergenic
939704301 2:145432666-145432688 AATCTAAAAATCACTGAACTGGG + Intergenic
941310062 2:163916555-163916577 ACACTAGAAATAACTGACGTGGG - Intergenic
942343031 2:174969844-174969866 ACACTGACAATTACTGTTCTAGG - Intronic
942469789 2:176248299-176248321 ACACTAACAGTCTATGATCTTGG + Intergenic
945579250 2:211572346-211572368 ACGCTAACAATCTGTGACATTGG + Intronic
945774248 2:214084641-214084663 ACATTTACAATTACTGACCTAGG + Intronic
947136620 2:226982364-226982386 ACAAAAACAATCCCTGACCTAGG - Intronic
948499210 2:238379285-238379307 ACACTCACCATCTCTGACCCGGG + Intronic
1170916927 20:20635333-20635355 ACTCTAACAATCAATAACTTTGG + Intronic
1171176972 20:23059127-23059149 ACACTCAGAAACACTGTCCTTGG + Intergenic
1172282475 20:33717979-33718001 ACACTAATATTGATTGACCTAGG - Intronic
1175753825 20:61516764-61516786 AAACCGACACTCACTGACCTGGG - Intronic
1176924174 21:14726657-14726679 CCACAAACAATCTTTGACCTAGG - Intergenic
1181768690 22:25110712-25110734 ACCCTAACACCCACTGTCCTCGG - Intronic
949230264 3:1742746-1742768 ACACTAACAGTCTCTGCCCATGG - Intergenic
952220640 3:31320779-31320801 CCACTATTAATCACTGCCCTTGG + Intergenic
952487319 3:33826576-33826598 ATAAAAACAATAACTGACCTTGG - Exonic
952523039 3:34181356-34181378 TCAAGAACAAACACTGACCTTGG - Intergenic
953308457 3:41852976-41852998 ACATTCACAATGACTCACCTGGG + Intronic
960420107 3:117434950-117434972 GCACTGAGAATCACTGACTTAGG - Intergenic
961110702 3:124280823-124280845 ACAGTAACTACTACTGACCTTGG - Intronic
964465984 3:156993593-156993615 AATCTACCAATCACTGACCCAGG - Intronic
966305837 3:178533749-178533771 TCACTAACAATCCCTGCCCCAGG + Intronic
966999590 3:185320379-185320401 ACACTAAAAGTCACTTACTTAGG - Intronic
967080390 3:186044354-186044376 ACCCAATCAACCACTGACCTGGG + Intergenic
968244785 3:197133643-197133665 ACATTAAGAAACAGTGACCTTGG + Intronic
968533826 4:1111974-1111996 CCTCTAACAATCACCGGCCTTGG - Intronic
968732004 4:2273642-2273664 ACAGTCACAAGCACTGGCCTGGG - Intronic
970812840 4:20115982-20116004 TCACTAACAACCACTGAGCTGGG - Intergenic
973633370 4:52839956-52839978 ACACTGGCAATCACTGAGCCAGG + Intergenic
976309471 4:83596317-83596339 ACACTGAAAATCACTTACTTTGG + Intronic
982542243 4:156688545-156688567 AAACAAACAATCACTGCCCCAGG - Intergenic
985723281 5:1501827-1501849 ACACTGACCAGCACTGACCAAGG + Intronic
986130838 5:4928546-4928568 AAACTTAGAATCACTGCCCTGGG + Intergenic
986199478 5:5568422-5568444 ACACAAACAGTCACAGACGTGGG - Intergenic
991179198 5:63729147-63729169 ACACTAAAAATTATAGACCTAGG - Intergenic
993159794 5:84275122-84275144 AAACTAACAAACACTGATTTGGG - Intronic
993538836 5:89122792-89122814 ACAGCAACAATAACTGCCCTTGG + Intergenic
994190967 5:96868797-96868819 ACTCTGAGAATCACTGCCCTAGG + Intronic
995075293 5:107976278-107976300 AAACTAACAATTACTGAAGTAGG + Intronic
995176700 5:109186328-109186350 ACACTAACAATGAATGTACTTGG - Intronic
997373038 5:133374172-133374194 ACACTCAGACTTACTGACCTGGG + Intronic
998308363 5:141101907-141101929 ACCATCACTATCACTGACCTGGG + Exonic
1000197606 5:158974755-158974777 ACAGCAACAATTTCTGACCTGGG + Intronic
1000790614 5:165602478-165602500 ACACTCACATTCACTCACCCCGG - Intergenic
1001141601 5:169148646-169148668 GCATAAACAATCCCTGACCTCGG + Intronic
1003426228 6:5999940-5999962 CCACTAACACTCACCGACCCCGG - Intronic
1006473764 6:34242581-34242603 CCACAAACCATCCCTGACCTAGG - Intronic
1006670976 6:35729414-35729436 CCTCGAGCAATCACTGACCTGGG - Intergenic
1007491414 6:42225356-42225378 ACCTTAACAAAAACTGACCTAGG + Exonic
1013504236 6:110783340-110783362 ACACTAAGAATATCTGAGCTGGG + Intronic
1014617416 6:123620382-123620404 ACACTGACAAACTCTGATCTGGG + Intronic
1017715592 6:157209858-157209880 ACAGTAACAGTCAATGACCCAGG - Exonic
1020356842 7:7286619-7286641 ACACTAACAATGAATGATCTAGG + Intergenic
1020795226 7:12670853-12670875 ACACCAAAAATCACTGAACTGGG - Intergenic
1022792425 7:33702307-33702329 ACACTGAGAATCACTGGTCTAGG - Intergenic
1029510883 7:100994254-100994276 ACACTCACAACCGCAGACCTCGG + Exonic
1029511380 7:100997503-100997525 ACACTCACAACCGCAGACCTCGG + Exonic
1029511603 7:100998925-100998947 ACACTCACAACCGCAGACCTCGG + Exonic
1029512100 7:101002174-101002196 ACACTCACAACCGCAGACCTCGG + Exonic
1030568464 7:111190629-111190651 TCACTAACAATATGTGACCTTGG + Intronic
1034744662 7:153513304-153513326 ACACTATCACTCAATGACCAGGG - Intergenic
1035740929 8:1928053-1928075 ACACTAATATTCAATGACCTAGG - Intronic
1035843084 8:2833447-2833469 ACACAGACAATCACTGAAATAGG + Intergenic
1036687324 8:10920727-10920749 ACACTAGCCATCACTGAGCACGG - Intronic
1041203302 8:55472529-55472551 ACTCCAACACTCACTGAACTGGG - Intronic
1041873349 8:62660207-62660229 GCACTAACGATGAGTGACCTTGG + Intronic
1044757691 8:95482074-95482096 ATACTAAAAATCAATGTCCTGGG + Intergenic
1045358363 8:101409839-101409861 ACAGTTACATTCATTGACCTTGG - Intergenic
1046547761 8:115673079-115673101 ACACACACAATCTCTGACCGGGG + Intronic
1048079587 8:131110841-131110863 ACACACAAAATCACTGCCCTTGG - Intergenic
1048787686 8:138068230-138068252 ACACAAACACACACTAACCTAGG + Intergenic
1050622543 9:7469520-7469542 AAAATAAAAATCACTGACCTTGG - Intergenic
1051419347 9:16874438-16874460 ACACTCACAATCACTCACACTGG - Intergenic
1051661679 9:19433126-19433148 CCACTCACACTCACTGGCCTAGG - Intronic
1053291307 9:36881458-36881480 AAACTGACAATCACCGGCCTGGG + Intronic
1055160539 9:73121112-73121134 TTACCAACAATCACTGAGCTTGG + Intergenic
1055219632 9:73913066-73913088 ACACTGAGAACCATTGACCTAGG - Intergenic
1055249369 9:74283637-74283659 ACCCTCACAAACACTAACCTAGG + Intergenic
1057544851 9:96010664-96010686 CTACCACCAATCACTGACCTAGG + Intronic
1059080589 9:111244992-111245014 TCACTAGCAATCCCTTACCTGGG + Intergenic
1186129351 X:6449426-6449448 AATCTAACCATCACTGACCTTGG + Intergenic
1187637850 X:21251986-21252008 ACACTAACATTCTCTGTCCTTGG - Intergenic
1188525991 X:31088442-31088464 ACACTCACACTCACTCACATTGG - Intergenic
1189199382 X:39178684-39178706 AAACTAACAATCCATGACCATGG + Intergenic
1190593881 X:52033469-52033491 TCACTAAAAGCCACTGACCTTGG - Intergenic
1190715732 X:53101695-53101717 ACACCAAAGATCACTGATCTAGG + Intergenic
1192054410 X:67758766-67758788 AGGCTCATAATCACTGACCTGGG + Intergenic
1195762062 X:108257306-108257328 ACCCTAATAATCACTGGGCTTGG - Intronic
1196684447 X:118498076-118498098 ACGGTAAAAATCAATGACCTTGG - Intronic
1201369262 Y:13243378-13243400 ACACTACAGAACACTGACCTAGG + Intergenic