ID: 1167851285

View in Genome Browser
Species Human (GRCh38)
Location 19:52204347-52204369
Sequence CTGGGAGATCAGATGGTGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 253}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167851280_1167851285 -1 Left 1167851280 19:52204325-52204347 CCTGAAAGAGTCACTCTGGGGTC 0: 1
1: 0
2: 1
3: 13
4: 138
Right 1167851285 19:52204347-52204369 CTGGGAGATCAGATGGTGTAGGG 0: 1
1: 0
2: 2
3: 14
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167851285 Original CRISPR CTGGGAGATCAGATGGTGTA GGG Intronic
902542496 1:17164960-17164982 ATGGGAGAACAGAGGGTGTGTGG + Intergenic
902550876 1:17218903-17218925 CTGGGAGATGAGGTGGTGGGAGG + Intronic
902848110 1:19128241-19128263 CTGGGAGAGCAGGTTGTCTAGGG + Exonic
903463380 1:23534840-23534862 CTGGGAGATGGGAAAGTGTAGGG - Intergenic
903780078 1:25815365-25815387 CAGGGTGATGAGATGGTGTCGGG + Intronic
903870771 1:26432806-26432828 CTGGGGAATCAGATGGACTATGG - Intronic
906568633 1:46818046-46818068 CTGGGAGATCAGACAGGGTGGGG + Intronic
908416113 1:63914897-63914919 TTGGGAGAGCAGATGGGGTCTGG + Intronic
909815788 1:79992136-79992158 CTGTGATATCAAATTGTGTAAGG - Intergenic
913168508 1:116211302-116211324 GTGGGAGGTCACATGGGGTAAGG - Intergenic
913683306 1:121207419-121207441 ATGGGAGGTCAGGTGGTGGAGGG - Intronic
914035147 1:143995043-143995065 ATGGGAGGTCAGGTGGTGGAGGG - Intergenic
914154305 1:145072927-145072949 ATGGGAGGTCAGGTGGTGGAGGG + Intronic
914847900 1:151292919-151292941 CTGGTGGAGCAGATGGTGGATGG - Exonic
915351057 1:155226465-155226487 TTGGGAGGCCAGATTGTGTAGGG + Intergenic
915647244 1:157281674-157281696 CTATGAGGTCAGATGGTGCAGGG + Intergenic
915687146 1:157645059-157645081 CAGGGAGTACACATGGTGTAGGG + Intergenic
916505712 1:165426446-165426468 CTTAGAGATCAGCTAGTGTAGGG - Intronic
916526483 1:165614753-165614775 TTGGGAGAACAGGTGGTGTTTGG + Intergenic
918348644 1:183630902-183630924 ATGGGAGGACAGATCGTGTAAGG + Intronic
919988603 1:202693014-202693036 TTGGGGGAACAGATGGTGTTTGG + Intronic
920470614 1:206225929-206225951 ATGGGAGGTCAGGTGGTGGAGGG - Intronic
921397959 1:214689043-214689065 CTGGGAGATGACATGGTCCAGGG - Intergenic
922978161 1:229802204-229802226 TTGGGGGAACAGATGGTGTTTGG - Intergenic
924476210 1:244384040-244384062 TGGGGAGAACAGATGGTGTTTGG - Intronic
924690749 1:246347707-246347729 CTGTGACATCACATGGTGGAAGG - Intronic
924928037 1:248702581-248702603 CTGGGAGAACAGAAGGGCTATGG - Intergenic
1062940218 10:1415185-1415207 GTGGGTGAACAGATGGTGGATGG + Intronic
1063470507 10:6280827-6280849 TTGGGGGAACAGATGGTGTTTGG + Intergenic
1063821293 10:9839391-9839413 TTGGGGGAACAGATGGTGTTTGG - Intergenic
1064952928 10:20874448-20874470 CTCTGAGATCAGCTGCTGTAAGG + Intronic
1065962586 10:30745909-30745931 CGGGCAGATCAGATGGTTTCAGG - Intergenic
1065966448 10:30774797-30774819 CTGGGACATCAGATGGCCCAGGG + Intergenic
1066206814 10:33197523-33197545 CTTGGAGACCAGATGCTGTGTGG + Intronic
1069064148 10:63925009-63925031 ATTTGAGATCAGAAGGTGTATGG + Intergenic
1074266874 10:111913352-111913374 CTCTGAGATCAGATCCTGTAAGG + Intergenic
1074298966 10:112216000-112216022 CTGGGAACTAAGAAGGTGTAGGG + Intergenic
1076919696 10:133445244-133445266 CTGGGGGATCAGGTGTTGGAGGG + Intergenic
1077613970 11:3661902-3661924 GTGGGAGAGCAGATGGTTGAGGG + Intronic
1078277426 11:9863248-9863270 CTGAGAGATGAGATGGTTAAGGG + Intronic
1078366188 11:10708298-10708320 CTGTGAGATCACATGGTGTGTGG - Intergenic
1079524213 11:21364812-21364834 CAGGGAGATGAGAAGGTGAAGGG + Intronic
1079587325 11:22142211-22142233 CTGGCAGATCAGTTGGTGGCGGG - Intergenic
1082728877 11:56770928-56770950 TTGGGGGAACAGATGGTGTTTGG + Intergenic
1082795527 11:57376080-57376102 ATGGGAGCTCAGTTGGTGTGGGG - Intergenic
1083071673 11:59990688-59990710 TTGGGAGAACAGGTGGTGTTTGG + Intergenic
1083701967 11:64485441-64485463 CTGGGAGTTCAGCTGGTGGGTGG - Intergenic
1084093590 11:66895237-66895259 CTGGGAGCTCAGTTGGGGAAGGG - Intronic
1084930899 11:72554859-72554881 CTAGGAGAACAGGTGGTGTTTGG + Intergenic
1090483691 11:127091786-127091808 TTGGGAGAACAGGTGGTGTTTGG - Intergenic
1091370607 11:135055036-135055058 CTGGGAGCTCAGGTGGAGAATGG - Intergenic
1096841181 12:54379868-54379890 CTGGGGGACCAGAGGCTGTAGGG + Intronic
1097775727 12:63642511-63642533 TTGGGAGATCATATGGAGCAAGG - Intronic
1100854968 12:98750349-98750371 CTGTGAGACCAGATGCTGGAGGG + Intronic
1104329968 12:127835587-127835609 CTTGGAGAACAGGTGGTGTTTGG + Intergenic
1105614335 13:21998712-21998734 CAGGGAGCTCAGAGGGTGGAGGG + Intergenic
1106855719 13:33849647-33849669 CTGGCAGATCAGTTGAGGTAAGG + Intronic
1107589343 13:41885497-41885519 CTGGGAGAGCAGTTAGTGTCTGG + Intronic
1110223574 13:73097018-73097040 AAGGGAGATCAGATGGTATATGG + Intergenic
1110755760 13:79171990-79172012 TTGGGGGAACAGATGGTGTTTGG + Intergenic
1111269741 13:85865606-85865628 GTTGAAGATCAGATGTTGTAGGG + Intergenic
1112271296 13:97972947-97972969 CAAGGAGATCAAATGGTGGAAGG - Intronic
1112927751 13:104697297-104697319 CTTGCAGATCAGAGGGCGTATGG + Intergenic
1113230222 13:108205695-108205717 CTGGAAAGTCATATGGTGTAGGG - Intergenic
1113273507 13:108701468-108701490 CTGGGTCATCCAATGGTGTAAGG - Intronic
1113640158 13:111951610-111951632 CTGGGATCTCAGATGGTCTCAGG - Intergenic
1114066838 14:19067445-19067467 TTTGAAGATCAGATGGTGTTAGG + Intergenic
1114095427 14:19332582-19332604 TTTGAAGATCAGATGGTGTTAGG - Intergenic
1114702193 14:24690504-24690526 CTGGGAGTACAAATGATGTAGGG + Intergenic
1115440788 14:33433329-33433351 CTGGGAAACAAGATGGTATAGGG + Intronic
1115793850 14:36910382-36910404 ATGGGAGATGAGATAGAGTACGG + Intronic
1115839354 14:37450038-37450060 CTGGCAGATCAGTTGATGTCAGG - Intronic
1116631152 14:47335549-47335571 ACAGGAGATCAGATTGTGTAGGG + Intronic
1118840037 14:69502979-69503001 CTAGAAGATCAGATGGGGCAGGG + Intronic
1118860437 14:69658815-69658837 CAGGGAGAGCAGAGGGTGGAGGG + Intronic
1120479429 14:85031204-85031226 CTTGTAGATCAGTTGGAGTAAGG + Intergenic
1120706191 14:87748297-87748319 CTGGCTAATGAGATGGTGTAAGG - Intergenic
1121399044 14:93655859-93655881 TTGGGAGATGGTATGGTGTAGGG - Intronic
1122254203 14:100464708-100464730 AGGGGAGATGAGATGGGGTAGGG - Intronic
1122254244 14:100464959-100464981 AGGGGAGATGAGATGGGGTAGGG - Intronic
1122277845 14:100604330-100604352 CTGGGAGAGCAGATTGGGGAAGG + Intergenic
1123632077 15:22268458-22268480 CTGGGACATCCCATGGTGGAAGG - Intergenic
1124096006 15:26649339-26649361 CTGGGTCATCACATGGTGGAGGG - Intronic
1125478136 15:40061459-40061481 TTGGGAGATCTGATGGTGAGAGG + Intergenic
1126549952 15:49917624-49917646 CTGGAGAATCAGATGGTGTTGGG + Intronic
1129297719 15:74609031-74609053 CAGGGAGAGCAGATGGTGTTGGG - Intronic
1130567260 15:85007186-85007208 CTAGGAGAACAGATGATATAGGG + Intronic
1130833930 15:87630957-87630979 CTGGGAGATCAGAGTGTTTAAGG - Intergenic
1131295874 15:91148736-91148758 CCAGGAGAGCTGATGGTGTAAGG + Intronic
1131341923 15:91610631-91610653 CTTGGAAATCAGATGGTGCTAGG - Intergenic
1131953603 15:97707476-97707498 CTGAGAGGTGACATGGTGTAGGG + Intergenic
1132622600 16:874885-874907 CTGGGGGATGATATGGTGTGGGG - Intronic
1133895810 16:9927994-9928016 CTGGCAGATCTGCTGGTGTCTGG - Intronic
1135162935 16:20113572-20113594 TTGGGGGAACAGATGGTGTTTGG - Intergenic
1135850476 16:25958744-25958766 CTGGGAGCTCAGTTGTTGGAGGG + Intronic
1141326161 16:83061357-83061379 CTGGGAATTCACATGGTGTAAGG - Intronic
1142601804 17:1056693-1056715 CCGGTAGATAAAATGGTGTATGG - Intronic
1143165658 17:4896122-4896144 CTGGGACTCCAGATGGTGTTAGG - Intronic
1143483277 17:7239031-7239053 GTTGGAGATCAGACGGTGTGGGG - Intronic
1143927889 17:10389260-10389282 CTGAGAGACCAGATCATGTAGGG - Intergenic
1145023792 17:19452679-19452701 CTGGGAGACCTGCTGGTATATGG - Intergenic
1145799020 17:27671715-27671737 CTGGGAGGTCAGATGCTGTAAGG - Intergenic
1146652440 17:34614940-34614962 CTGGGAGATCAGCTGGGCCATGG - Intronic
1146838183 17:36129145-36129167 ATGGGAGAACAGCTGGTGTGTGG - Intergenic
1147926967 17:43952404-43952426 CTAGGAGAGCAGATGGGGTCAGG - Intergenic
1148968983 17:51462845-51462867 ATAGGAGATGAGATGGTGGAAGG - Intergenic
1149628286 17:58096259-58096281 TTGGGAGATTAAATGGTTTAAGG - Intergenic
1152446206 17:80345839-80345861 CTGTGTGATCATATGGTGGATGG + Exonic
1152447267 17:80353081-80353103 CTGGGGGAGCAGGTGGTGGAAGG + Intronic
1156095443 18:33525991-33526013 TTGGGAGAACAGGTGGTGTTTGG + Intergenic
1156841024 18:41609442-41609464 CTGGGAGAAGTGATGGTGTCTGG - Intergenic
1159041993 18:63333048-63333070 GTAGGAGATCAGGTGGTTTATGG + Intronic
1162082237 19:8225104-8225126 CAGGGAGAGCAGATGGTGTGAGG + Intronic
1162855751 19:13467197-13467219 CTGGGAGGTGGGATGGGGTAAGG + Intronic
1165286905 19:34850172-34850194 TGGGGAGGTCAGATGGTGTAGGG + Intergenic
1165913463 19:39244020-39244042 CTGGGAGAGGATATGGTGCAGGG + Exonic
1165917493 19:39269603-39269625 CTGGGAGAGGATATGGTGCAGGG - Exonic
1167851285 19:52204347-52204369 CTGGGAGATCAGATGGTGTAGGG + Intronic
926678159 2:15643931-15643953 CTGGGATATCTGATGATGAAGGG - Intergenic
930673619 2:54177243-54177265 ATAGGAGATCAGATGGTGGGAGG + Intronic
932582982 2:73004628-73004650 CTGGGAGACCAGAGGGAGTGTGG + Intronic
933601354 2:84334677-84334699 TTGGGGGAACAGATGGTGTTTGG - Intergenic
934946416 2:98545733-98545755 CTGGGTGCTCAGGTGGTGAATGG - Intronic
935061805 2:99615214-99615236 CTGGGAGTCCAGATGGTAGAGGG + Intronic
935391685 2:102559594-102559616 CAGGGAGCTCTGATGGTGTGGGG + Intergenic
936633445 2:114229611-114229633 GTGGAAGATCAGATGGTGGTAGG + Intergenic
937138655 2:119578053-119578075 CTGGGAGCTCAGATGGCCTGAGG + Intronic
937271542 2:120656068-120656090 CTGGAAGATGAGATTGTGGATGG + Intergenic
937610196 2:123851967-123851989 CTGGGAACTCAGATGGGGAAAGG + Intergenic
937793469 2:125987992-125988014 TTGGGGGAACAGATGGTGTTTGG + Intergenic
938405378 2:131029988-131030010 CTGTGACACCAGATGGTGTGAGG + Intronic
938484235 2:131687536-131687558 TTTGAAGATCAGATGGTGTTAGG + Intergenic
938602153 2:132853401-132853423 CTCGGAGATCAGATGCCTTAAGG - Intronic
941762239 2:169257036-169257058 TTGGGTGATATGATGGTGTAAGG - Intronic
942277821 2:174335782-174335804 CTGGGAGATGAGCCGGTTTACGG + Intronic
943247081 2:185469070-185469092 GTGGGGGATCAGAGGGGGTAAGG - Intergenic
943826690 2:192403812-192403834 CTGGGAGATAAAAAGATGTAGGG - Intergenic
945377091 2:209091620-209091642 CTGGGAGAACAGGTGGTGTTTGG + Intergenic
945387492 2:209220301-209220323 TTGGGAGACCACATGGTGTTTGG - Intergenic
945524761 2:210874463-210874485 CTGTGTTATCAGATGGTGGAAGG + Intergenic
946074593 2:217063555-217063577 TTGGGAGAGCAGATGGTGGGAGG + Intergenic
948391253 2:237613088-237613110 CTGGGAGACCAGGTGGTGGTTGG - Intergenic
948737316 2:240017422-240017444 CTGGGAGATGGGATAGTGTCAGG - Intronic
948770538 2:240249353-240249375 ATGGGAGATCCCATGGGGTAGGG - Intergenic
1168961618 20:1874025-1874047 CTGGGAGGTCACAGGGTGAAAGG - Intergenic
1170865823 20:20156129-20156151 TTGGGAGAACAGTTGGTGTTTGG - Intronic
1172669427 20:36624680-36624702 CTGTGAGCACAGATGGTGTTGGG + Intronic
1175237708 20:57525572-57525594 CTGGGAGATCTGAGGGGGAATGG + Intronic
1175255266 20:57641156-57641178 CTGGGAACTCATATGGTGGAAGG - Intergenic
1176406879 21:6374430-6374452 GTGAGAGATAGGATGGTGTATGG + Intergenic
1180086192 21:45509002-45509024 CTGGGAGATTAGAAGGTCGAAGG + Intronic
1180485321 22:15790029-15790051 TTTGAAGATCAGATGGTGTTAGG + Intergenic
1181341681 22:22185821-22185843 CTGCGAGCTCACATGGTGGAAGG - Intergenic
1181639431 22:24188931-24188953 CTGGGACCCCAGATGGGGTAAGG + Exonic
1182970710 22:34573483-34573505 TTGGGAGAACAGGTGGTGTTTGG + Intergenic
1183005704 22:34899962-34899984 CTGGGGGATCAGCTGGAGTTTGG + Intergenic
1183192812 22:36332546-36332568 CTGGGAGATCACAGGGGCTATGG - Intronic
1183786883 22:40034480-40034502 CTGGGAGAGCAGAAGCTGCAAGG - Exonic
1184254079 22:43277110-43277132 CTGGGGGATCAGGAGGTGTGCGG + Intronic
1184654816 22:45935715-45935737 CTTGGAGATAAGGTGGTGTGGGG - Intronic
1185032796 22:48453563-48453585 CTGAGAGAGCAGATGGGGCAAGG + Intergenic
950442214 3:13016626-13016648 CAGAGAGAGCAGCTGGTGTAAGG - Intronic
950947790 3:16968053-16968075 GTTGGAGATCAGATGGTTTTAGG + Intronic
950997924 3:17524629-17524651 CTGGGAGATCACCTGAGGTAAGG + Intronic
952523286 3:34184030-34184052 CTGGGAGAGGAGGTGGTGGAAGG - Intergenic
953192664 3:40702151-40702173 TTGGGAGATAATAAGGTGTAAGG - Intergenic
953988089 3:47461040-47461062 CTGGGAGATAAGGTGGTGGAAGG - Intronic
954412051 3:50375050-50375072 CTGGGAGGGGAGATGGTGTGGGG - Intronic
955716828 3:61838119-61838141 CTGAGATTTCAGATGGTGAATGG + Intronic
956226508 3:66965099-66965121 CTTGGAGATCAGATCATGTCAGG - Intergenic
957419133 3:79945727-79945749 TTGGGAGAACAGGTGGTGTTTGG - Intergenic
957691267 3:83573448-83573470 TTGGGAGAACAGGTGGTGTTCGG - Intergenic
958263502 3:91409464-91409486 CTGGGAGCTCAGAGGGATTAGGG + Intergenic
959210849 3:103378339-103378361 CTGGGTCCTCACATGGTGTAAGG + Intergenic
960245612 3:115397098-115397120 ATGGCAGGTCAGATGGTGAATGG + Intergenic
961570620 3:127795858-127795880 CTGGGTGATAAGATTGTGGATGG - Intronic
962192410 3:133325436-133325458 TTGGCAGAACAGATGGTGTTTGG - Intronic
964076203 3:152695217-152695239 TTTGGAGAACAGATGGTGTTTGG - Intergenic
965438021 3:168676584-168676606 CTGGGAGAACAGGTAGTGTTTGG + Intergenic
967221913 3:187254620-187254642 ATGGGAGAATAGATTGTGTAGGG + Intronic
969350301 4:6594437-6594459 CTGGGAGGGCAGCTGGTGGAGGG + Intronic
970164789 4:13225081-13225103 CTTTGAGATCAGGTGGTGTGAGG - Intergenic
970488124 4:16544643-16544665 CTGGGAGATAAGAGGGAGTGAGG + Intronic
970552146 4:17193070-17193092 CTGGAAGATCAGCTGGGGTCTGG - Intergenic
971471738 4:27033948-27033970 TTGGGAGAACAGGTGGTGTTTGG + Intergenic
971509239 4:27403583-27403605 TTGGGGGAACAGATGGTGTTTGG - Intergenic
974508573 4:62807849-62807871 GTGGGAGAGCAGAGGGGGTAGGG + Intergenic
975204617 4:71630441-71630463 TTGGGGGAGCAGATGGTGTTTGG - Intergenic
976185260 4:82436808-82436830 CTGGGTGAGCAGATTGTCTAAGG - Intronic
977072913 4:92415344-92415366 TTGGGAGAACAGGTGGTGTTTGG + Intronic
979094512 4:116529536-116529558 CATGGAGTCCAGATGGTGTAAGG + Intergenic
980509559 4:133767456-133767478 ATTGGAGATCAGATGGTAAAAGG + Intergenic
980903296 4:138925458-138925480 CTGGGAGATCAGATGGATTAAGG + Intergenic
981578316 4:146227713-146227735 ATGGGAAATTAGATGGTGGAGGG + Intronic
984136843 4:175951938-175951960 CCAGGAGAGCCGATGGTGTAGGG - Intronic
984930286 4:184841262-184841284 CTGGGAGGTCACATGAAGTATGG + Intergenic
985008713 4:185560531-185560553 CTGGGAGACCTGAAGGTGCAGGG - Intergenic
985767174 5:1786211-1786233 CTGGGGGGTCAGATGGGGCAGGG - Intergenic
985892136 5:2724318-2724340 TTGGGAGATGGGATCGTGTAAGG - Intergenic
990352712 5:54934851-54934873 CTGGGAGATCAGAAGGTGACAGG + Intergenic
990940778 5:61200787-61200809 CTGGGAGCTCAGTTGGTCTTAGG + Intergenic
991915488 5:71600754-71600776 CTGGGAGCTCAAATGGTCTTAGG + Intronic
992805576 5:80334091-80334113 CTTGGGGGTCAGATGGGGTAAGG - Intergenic
993499540 5:88649646-88649668 TTGGGGGAACAGATGGTGTTTGG - Intergenic
994158290 5:96527428-96527450 CTTTGAGATCAGAGGGTGAAAGG - Intronic
995580948 5:113601601-113601623 ATGAGAGATCAGATTATGTAAGG - Intergenic
998146462 5:139731822-139731844 GTGGCAGAGCAGATGGTGTGTGG + Intergenic
999985420 5:156999908-156999930 TTGGGAGAACAGGTGGTGTTTGG + Intergenic
1000217854 5:159181051-159181073 CTGGGGGAACACATGGTGTTTGG - Intronic
1000272033 5:159695222-159695244 TTTGGAGAACAGATGGTGTTTGG - Intergenic
1001335338 5:170791927-170791949 CTGTGTCATCAGATGGTGGAAGG + Intronic
1001565168 5:172695463-172695485 CTGGGAGATCAGAGCCTGAAGGG - Intergenic
1003892967 6:10579890-10579912 GTGTGAGATCATTTGGTGTAAGG - Intronic
1004025972 6:11818911-11818933 CTACCAGATCAGATGGTGGATGG - Intergenic
1005930366 6:30479531-30479553 TTGGGAGAACAGGTGGTGTTTGG - Intergenic
1005995244 6:30926877-30926899 CATGGAGATGAGATGGTGTTTGG - Intergenic
1006030558 6:31173913-31173935 CTGGGAGATGAGGTGCTGTTTGG + Intronic
1006812198 6:36827224-36827246 GTGTGGGATCAGAGGGTGTAGGG - Intronic
1007026131 6:38576631-38576653 GTGGGAGATCAGATGGGTCATGG + Intronic
1007068813 6:39019733-39019755 CTGAGAGGTCAGATGCTGAATGG + Intronic
1008231975 6:48994305-48994327 TTGGGGGAACAGATGGTGTTTGG - Intergenic
1014735000 6:125083036-125083058 CTGGGAGATGAGATGGTAGAAGG - Exonic
1014983319 6:127972020-127972042 CAGGGAAATGAGGTGGTGTAGGG + Intronic
1015529616 6:134208404-134208426 TTTGGGGAACAGATGGTGTATGG + Intronic
1015773017 6:136788142-136788164 GTTGAAGATCAGATGGTGTTAGG - Intronic
1016797171 6:148130546-148130568 GTGGGAGATCAAATGTTTTAAGG - Intergenic
1020403135 7:7800465-7800487 TTGGGGGAACAGATGGTGTTTGG + Intronic
1024159915 7:46663516-46663538 CTGGGAAAGCAGAGGGAGTAAGG + Intergenic
1024255868 7:47539644-47539666 CTGGGAGGTCAGATGGGGGGCGG - Intronic
1028188272 7:87815288-87815310 CTAGGAAATTAGATGGTGTTTGG + Intronic
1030438611 7:109556785-109556807 GTGGAAGATCAGATGGTTTTAGG - Intergenic
1032413836 7:131720816-131720838 CAGGGAGATGAGATGTTCTAGGG - Intergenic
1032753691 7:134867695-134867717 CAGGGAGACCAGATGATGTCTGG - Exonic
1033105433 7:138516994-138517016 CTGGGAGGTGAGATGGTGGGAGG + Intronic
1035756049 8:2033870-2033892 CTGGGAGCTCAGATAGGGCAAGG - Intergenic
1036433821 8:8714504-8714526 CTAGGAGTTCAGATGTTGGATGG + Intergenic
1041013588 8:53569054-53569076 GTTGAAGATCAGATGGTGTGTGG + Intergenic
1042180452 8:66082136-66082158 ATGGGAGATCCTATGGTCTATGG - Intronic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1045342364 8:101266316-101266338 CTGCTAGAGCAGAAGGTGTATGG + Intergenic
1046627711 8:116592846-116592868 CTGGGAGATTTGCTGGTTTATGG - Intergenic
1047938520 8:129804983-129805005 CTGGGAGGTCAGAAGGGGTGGGG + Intergenic
1051062758 9:13064099-13064121 CTGAGTGAACAGATGGTGTAGGG + Intergenic
1054885228 9:70190397-70190419 CTGGGGGATCTGTTGGTTTAAGG - Intronic
1054941018 9:70741939-70741961 TTGGGGGAACAGATGGTGTTTGG - Intronic
1055015847 9:71617075-71617097 CTTGGAGATCAGATGGTTGTAGG - Intergenic
1056901260 9:90601913-90601935 TTGGGGGAACAGATGGTGTTTGG + Intergenic
1056913072 9:90720736-90720758 TTGGGAGAACAGGTGGTGTTTGG - Intergenic
1057392709 9:94652901-94652923 CTGGGGGGCCAGATGGTGCAGGG - Intergenic
1057899294 9:98935632-98935654 CTGAGACATGAGATGCTGTAGGG - Intergenic
1058775495 9:108279659-108279681 TTGGGAGATCAGAGGGAGAAGGG + Intergenic
1062319773 9:135985081-135985103 CGGGCAGATCACATGATGTAAGG + Intergenic
1062465406 9:136678599-136678621 CTGGGGGATCAAATGGTGGGGGG - Intronic
1185998233 X:4977683-4977705 CTGGGAGAACTGAGGGTGTGAGG + Intergenic
1186149649 X:6660788-6660810 CTGGGATATAAGATGGTGGAAGG - Intergenic
1188050172 X:25474843-25474865 CTAGGAGACCAGAGGGTGCAGGG + Intergenic
1188431950 X:30113575-30113597 CTGTGACATCACATGGTGGAAGG + Intergenic
1188640792 X:32501754-32501776 CTGGTGGAACAGATGGTGAATGG - Exonic
1188976651 X:36683541-36683563 CTGAGTGAGCAGATGGTGGAAGG - Intergenic
1189900249 X:45699137-45699159 CTGGCAGATCAGATGGCCCATGG + Intergenic
1191835926 X:65461948-65461970 TTTGGAGATCAGGTGGTGTTTGG - Intronic
1192530893 X:71883701-71883723 TTGGGGGAACAGATGGTGTTTGG + Intergenic
1193252199 X:79304599-79304621 GTTGAAGATCAGATGGTGTTAGG - Intergenic
1193551082 X:82893460-82893482 CCTGGAGATCTGCTGGTGTATGG - Intergenic
1195121235 X:101755124-101755146 CTGGTACCTCAGATGGTGCAGGG - Intergenic
1195476258 X:105289253-105289275 GTGGGGGATCAGATCATGTAGGG + Intronic
1198233104 X:134712263-134712285 CTGGGAAGTCAGATGGGGTATGG - Intronic
1198268368 X:135032058-135032080 CAGGGAGACCTGGTGGTGTACGG - Intergenic
1198796644 X:140403760-140403782 TTTGGAGAACAGATGGTGTCTGG + Intergenic
1199655893 X:149995184-149995206 CTGGGAGATTTACTGGTGTAGGG - Intergenic