ID: 1167853057

View in Genome Browser
Species Human (GRCh38)
Location 19:52216408-52216430
Sequence GCCCCTCTCATTCATAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 98}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167853057_1167853059 1 Left 1167853057 19:52216408-52216430 CCTGCTCTATGAATGAGAGGGGC 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1167853059 19:52216432-52216454 GAAGCAGGTTATTGTCTCTTAGG 0: 1
1: 0
2: 1
3: 16
4: 133
1167853057_1167853060 7 Left 1167853057 19:52216408-52216430 CCTGCTCTATGAATGAGAGGGGC 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1167853060 19:52216438-52216460 GGTTATTGTCTCTTAGGAGTTGG 0: 1
1: 0
2: 1
3: 10
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167853057 Original CRISPR GCCCCTCTCATTCATAGAGC AGG (reversed) Intronic
900252044 1:1675990-1676012 GTCCCTCTCGTTACTAGAGCGGG - Intronic
900262455 1:1738848-1738870 GTCCCTCTCGTTACTAGAGCGGG - Intronic
902519970 1:17010765-17010787 GCCCCTCTGATCCACAGTGCTGG - Intronic
906098681 1:43241748-43241770 GCCCCTCTGACTCATAGGTCTGG - Intronic
908414985 1:63904423-63904445 GCCCCTGTGCTTCATAGACCTGG + Intronic
916188663 1:162157774-162157796 GCCCCATTCATTCTTTGAGCTGG + Intronic
918442784 1:184584900-184584922 TCTGCTCTCATTCATAGTGCTGG - Intronic
920304068 1:205007708-205007730 GCCGCTCTCATTCCTACTGCAGG - Intronic
920420342 1:205828858-205828880 GCCCCTCTCTTTCCTAGCCCTGG - Intronic
1062830916 10:605147-605169 TCCCCTCTGATGCAGAGAGCTGG + Intronic
1063230542 10:4062156-4062178 GCTCCTCTCATTCCAAGAACAGG + Intergenic
1065622650 10:27599464-27599486 GCCCCTCTCAGCCATAGTCCAGG - Intergenic
1069625751 10:69866800-69866822 GCTCCTCCCATTCCCAGAGCCGG - Intronic
1070996314 10:80786341-80786363 TCCCCTCTCATTCAGAGTGTGGG + Intergenic
1073381375 10:103080306-103080328 GCCCTCCTCATTTACAGAGCAGG - Exonic
1084403157 11:68956367-68956389 GCCCCTCCCACTCACAGAGCAGG - Intergenic
1087094269 11:94305169-94305191 GCCCCTCACCTTCATAGCCCAGG - Intergenic
1087380431 11:97398543-97398565 GCTCCTCTCAGGCACAGAGCAGG + Intergenic
1090227748 11:125081803-125081825 GCCGCTCTCCCTGATAGAGCAGG - Exonic
1091138689 11:133217107-133217129 GCCCTTTTCCTTCAGAGAGCAGG + Intronic
1094058282 12:26287814-26287836 GCACCTCTCATTCCCAGAGAAGG + Intronic
1095624253 12:44296301-44296323 GCCCCTCTCAGCCATAGTCCAGG - Intronic
1095646712 12:44556601-44556623 GCCCCTCACATCCATGGAGGAGG - Intronic
1098580542 12:72094298-72094320 GCCCCTCTCAGCCATAGTCCAGG - Intronic
1099066953 12:77992840-77992862 GCCTCTCCTATTCATAGACCAGG - Intronic
1100636732 12:96441806-96441828 TCCCCTCCCAATAATAGAGCTGG - Intergenic
1101814344 12:108134277-108134299 GCTCTTCTCATTCAAGGAGCAGG + Intronic
1103613863 12:122140059-122140081 ATCCCTGTCATTAATAGAGCTGG + Intronic
1106351343 13:28933597-28933619 GGCCCGCCCAATCATAGAGCAGG - Intronic
1109035140 13:57248786-57248808 TGCTTTCTCATTCATAGAGCAGG + Intergenic
1122313111 14:100809763-100809785 GCACCTCTCACTCACTGAGCAGG - Intergenic
1122452301 14:101819428-101819450 GCGCCTTTCTTTCATCGAGCAGG + Intronic
1123381958 15:19685769-19685791 AACACTCCCATTCATAGAGCAGG + Intergenic
1125713242 15:41804186-41804208 GCTCTTCTCATTCAAAGGGCAGG - Intronic
1130070082 15:80639794-80639816 GCCCCTCACATGCAAACAGCGGG + Intergenic
1132888859 16:2194673-2194695 GCCCCTGTGAGTCAGAGAGCAGG + Intronic
1135650425 16:24201625-24201647 GCCCCTCTTAGCCAGAGAGCTGG + Intronic
1145413642 17:22694901-22694923 GCCACTCCCATTCATAGACCAGG + Intergenic
1145414527 17:22703874-22703896 GCCACCCCCATTCATAGACCAGG - Intergenic
1149259434 17:54862915-54862937 GGCCATCTCACTCACAGAGCAGG + Intergenic
1154408643 18:14121967-14121989 AGTCCTCTCATTCAAAGAGCTGG - Intronic
1156498786 18:37543828-37543850 GCCTCTCTCATTCATCTAGAGGG - Intronic
1164550696 19:29209861-29209883 GCCCTTCTCATTCAGAGATTTGG + Intronic
1167853057 19:52216408-52216430 GCCCCTCTCATTCATAGAGCAGG - Intronic
925982965 2:9191998-9192020 GCCCCACACATTCACAGACCTGG + Intergenic
926045694 2:9708159-9708181 GCCCATCTCACTCACAGAGAAGG + Intergenic
933278961 2:80311390-80311412 GCCCCTCTCCTTCATCTGGCTGG + Intronic
935090434 2:99890663-99890685 GCCCCTGTCCTTCAAAGGGCAGG + Intronic
936526476 2:113244966-113244988 GCCCCTGTCATTCACACATCAGG - Intronic
937153722 2:119703432-119703454 GCCCATCACACTCATTGAGCAGG + Intergenic
945600908 2:211863931-211863953 GACCCTCTGCTTCATAGAGAGGG + Intronic
945975621 2:216268237-216268259 ACCCCTCTCATTTATAGATGAGG + Intronic
946827576 2:223694764-223694786 GGCCCACTCATTCATAAAACTGG - Intergenic
947988017 2:234465379-234465401 GCAGCTCTCAGTCATTGAGCGGG - Intergenic
1169244603 20:4015610-4015632 GCGCCTCTCATTCATGCAGCGGG + Intergenic
1171598941 20:26720910-26720932 AACCTTCCCATTCATAGAGCAGG + Intergenic
1171621972 20:27066456-27066478 AACCTTCCCATTCATAGAGCAGG + Intergenic
1171681239 20:27954864-27954886 AACCTTCCCATTCATAGAGCAGG + Intergenic
1171693229 20:28134333-28134355 AACCTTCCCATTCATAGAGCAGG + Intergenic
1173135442 20:40434888-40434910 GCCCTTGCCTTTCATAGAGCAGG + Intergenic
1173851403 20:46220663-46220685 GCCTCTCTCACTCACAGAGGTGG - Intronic
1174528877 20:51195272-51195294 CTTCCTCTCCTTCATAGAGCTGG + Intergenic
1179382004 21:40908431-40908453 GCCCCGCTTACTCACAGAGCTGG - Intergenic
1179679000 21:43004825-43004847 GCCCCTCTCATGCCTACAACTGG - Intronic
1183249018 22:36715363-36715385 GCCACTCACATACAGAGAGCTGG + Intergenic
950348968 3:12328306-12328328 GCCCCTCTCATTCCTGGTGGGGG + Intronic
951375497 3:21910309-21910331 TCCCCTCTATTTCAGAGAGCTGG - Intronic
952163225 3:30716993-30717015 ACACCTCTCATTCATTAAGCTGG + Intergenic
952172075 3:30818098-30818120 TCCCCTCTCATCCATAGACATGG + Intronic
952506762 3:34014310-34014332 GCCTCTGCCATGCATAGAGCTGG - Intergenic
955754596 3:62214998-62215020 GCCCCTCCCATTCCTACTGCAGG - Intronic
957897451 3:86441736-86441758 GCCTTTCTCATTCATATGGCTGG + Intergenic
963965465 3:151364203-151364225 GCCAGTCTCATTCACAGAGCAGG + Intronic
968620916 4:1603120-1603142 GCCCCACTCATACACACAGCTGG - Intergenic
977983914 4:103360065-103360087 GCCCCTCCCATTCACAGGCCTGG + Intergenic
982115414 4:152094841-152094863 GCCCCTTTCCTTCAAAGAGGAGG + Intergenic
983112042 4:163763279-163763301 GTCATTCTCATTCATTGAGCAGG + Intronic
986064287 5:4220664-4220686 GCCCCACGCATTCAAAGAGATGG - Intergenic
993522754 5:88924111-88924133 GCTCCTCTCATTAAGAAAGCAGG + Intergenic
995199981 5:109414896-109414918 GCCCCTTCCATTCATAGGTCTGG + Intergenic
998588325 5:143451509-143451531 GACTCTCTTATTCAGAGAGCTGG - Intergenic
1001930051 5:175666335-175666357 GCCCCTCTCAGTCACAGCACAGG + Intronic
1002269188 5:178058558-178058580 ACACCTCTCATCCACAGAGCAGG - Intergenic
1003317708 6:5026836-5026858 GCCCCCTTCATTTATAGAGGAGG - Intergenic
1003895014 6:10599168-10599190 GCTCCTCTCATTCCTTGTGCAGG - Intronic
1004486563 6:16072037-16072059 GCCCATCTCATGCTTAGATCAGG - Intergenic
1010845479 6:80702242-80702264 GCCCCTCTCTGTCATAGGCCTGG + Intergenic
1012095400 6:94951333-94951355 GCCCAATTCATTCATAGAGCAGG - Intergenic
1015918037 6:138238075-138238097 GTCAAACTCATTCATAGAGCAGG + Intronic
1017455088 6:154594256-154594278 GCCCAGCTCATTTATTGAGCTGG - Intergenic
1031997438 7:128241777-128241799 GCCCCTCTCATTCAGAGGTCAGG - Intronic
1040151001 8:44119118-44119140 AACATTCTCATTCATAGAGCAGG + Intergenic
1040193009 8:44740816-44740838 AACATTCTCATTCATAGAGCAGG + Intergenic
1040211818 8:45019815-45019837 AACATTCTCATTCATAGAGCAGG + Intergenic
1043998785 8:86852596-86852618 TCCCCCCTAATTCATGGAGCTGG + Intergenic
1048431247 8:134373469-134373491 GCTCCTCTCATCAAGAGAGCAGG + Intergenic
1049514043 8:143044213-143044235 GCGCCTCTCCTGCATGGAGCTGG + Intronic
1050583641 9:7086879-7086901 TCCCCTCTCCTTCACAGAGTGGG + Intergenic
1053380062 9:37641569-37641591 CCCCCTCTGATTCAAAGAACAGG + Intronic
1060558583 9:124523576-124523598 GCCACTCTCCTCCATAGAACTGG - Intronic
1187299602 X:18034944-18034966 GACCCTCTCATTCTGAGAGCTGG - Intergenic
1188790785 X:34405585-34405607 GCCCCTCTGATTCACAGTGTAGG + Intergenic
1194751709 X:97692655-97692677 GCCCAGCTCCTTCATAAAGCTGG - Intergenic
1195655652 X:107329197-107329219 GCCTCTCTCTGTCATAGCGCTGG + Intergenic
1197757611 X:130006870-130006892 GCCTCTCTCATTTTTAGAGAAGG + Intronic
1201457777 Y:14189249-14189271 TCCCCTCCCATTGACAGAGCAGG - Intergenic