ID: 1167854835

View in Genome Browser
Species Human (GRCh38)
Location 19:52229086-52229108
Sequence CATCAGGGCTGGAGGGAAGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 940
Summary {0: 1, 1: 0, 2: 5, 3: 73, 4: 861}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167854822_1167854835 23 Left 1167854822 19:52229040-52229062 CCCCGAGGAGTGAACTGCAGGGC 0: 1
1: 0
2: 1
3: 7
4: 101
Right 1167854835 19:52229086-52229108 CATCAGGGCTGGAGGGAAGGAGG 0: 1
1: 0
2: 5
3: 73
4: 861
1167854819_1167854835 29 Left 1167854819 19:52229034-52229056 CCTCAGCCCCGAGGAGTGAACTG 0: 1
1: 0
2: 2
3: 16
4: 126
Right 1167854835 19:52229086-52229108 CATCAGGGCTGGAGGGAAGGAGG 0: 1
1: 0
2: 5
3: 73
4: 861
1167854824_1167854835 21 Left 1167854824 19:52229042-52229064 CCGAGGAGTGAACTGCAGGGCAC 0: 1
1: 0
2: 1
3: 12
4: 155
Right 1167854835 19:52229086-52229108 CATCAGGGCTGGAGGGAAGGAGG 0: 1
1: 0
2: 5
3: 73
4: 861
1167854826_1167854835 -1 Left 1167854826 19:52229064-52229086 CCGACAAGATTCTGCCTGTGGCC 0: 1
1: 0
2: 4
3: 14
4: 190
Right 1167854835 19:52229086-52229108 CATCAGGGCTGGAGGGAAGGAGG 0: 1
1: 0
2: 5
3: 73
4: 861
1167854823_1167854835 22 Left 1167854823 19:52229041-52229063 CCCGAGGAGTGAACTGCAGGGCA 0: 1
1: 0
2: 1
3: 12
4: 161
Right 1167854835 19:52229086-52229108 CATCAGGGCTGGAGGGAAGGAGG 0: 1
1: 0
2: 5
3: 73
4: 861

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167854835 Original CRISPR CATCAGGGCTGGAGGGAAGG AGG Exonic
900001191 1:15726-15748 ACTCAGGGCTGGAGGGGAGGAGG + Intergenic
900020906 1:186247-186269 ACTCAGGGCTGGAGGGGAGGAGG + Intergenic
900366162 1:2312798-2312820 CATCATTTCTGGAGGGCAGGCGG - Intergenic
900421424 1:2557508-2557530 CATCAGGGCTGGAGGAGGGGCGG + Intronic
900428737 1:2592308-2592330 CATCAGCGCTGCAGGGGAGGGGG - Intronic
900428762 1:2592379-2592401 CATCAGCGCGGCAGGGGAGGGGG - Intronic
900428811 1:2592517-2592539 CATCAGCGCGGCAGGGGAGGGGG - Intronic
900436646 1:2634198-2634220 CACCAGGGCTGTCGGGCAGGTGG - Intergenic
900535931 1:3177524-3177546 CAGCAGCCCTGGAGGGAAGGTGG - Intronic
900760026 1:4464120-4464142 CAGTGGGGTTGGAGGGAAGGAGG - Intergenic
900790213 1:4675053-4675075 CATCAGGGCTGGAGAGCGGTGGG + Intronic
901770837 1:11529625-11529647 CATCGGGGCTGGAGCTAAGCAGG - Exonic
901794196 1:11671174-11671196 CAGGAGGGCGGGAGGGAGGGTGG - Intronic
902546494 1:17193738-17193760 CATCCAGGCTGGAGAGCAGGGGG + Intergenic
902558463 1:17260909-17260931 CATGATGGCTGGTGGGATGGAGG + Intronic
902559462 1:17267910-17267932 CATCATAGCTGGAGGTATGGAGG - Exonic
902612987 1:17608026-17608048 CTTCAGGGAGGGAGGGAGGGAGG + Intronic
902809128 1:18878348-18878370 CCTCAGGGAGGCAGGGAAGGAGG + Intronic
902990541 1:20184644-20184666 CATTAGAACTGGAGGGAGGGAGG + Intergenic
903499971 1:23795334-23795356 CTCCAGGCCTGCAGGGAAGGAGG - Exonic
903774654 1:25785106-25785128 CATCAGGGAGGGTGGGAAAGGGG - Exonic
903807020 1:26012859-26012881 GATCAGGCCTGGAGGGAAGCAGG - Intergenic
903959011 1:27044910-27044932 CTCCAGTGCTGGAGGGAAAGGGG - Intergenic
904006382 1:27365556-27365578 CATCCGGGCTGGCTGGAGGGAGG + Intronic
904253405 1:29239823-29239845 CATGAGGGAAAGAGGGAAGGAGG - Intronic
904373220 1:30063918-30063940 CATCAGGGCTGGTGGGCACCTGG - Intergenic
904612979 1:31735440-31735462 CATCAAGGTTGCAGGCAAGGTGG - Intronic
904905404 1:33894143-33894165 CCCCAAGGCTGAAGGGAAGGTGG + Intronic
905387649 1:37615252-37615274 CACCAGGGAGGGAAGGAAGGAGG - Intronic
905538860 1:38744523-38744545 CAAAAGGGCTGGAGGGAACTAGG + Intergenic
905869617 1:41395553-41395575 CGGCAGGGCTGGATGGAAGTGGG + Intergenic
905958021 1:42015524-42015546 GAGGAGAGCTGGAGGGAAGGAGG - Intronic
906212784 1:44021354-44021376 CATCTGGGCTGGAGTGAGGGAGG + Intronic
906722207 1:48016917-48016939 AGTCAGGGCAGGAGGGAGGGAGG - Intergenic
908228488 1:62080370-62080392 CACCCAGGCTGGAGGGCAGGGGG + Intronic
908330090 1:63062750-63062772 TCTCAGGGGTGGAGGGGAGGGGG + Intergenic
908601638 1:65745485-65745507 CATGAGGGCAGGAGAGAAAGAGG - Intergenic
908956270 1:69632212-69632234 GATCATTGCTGGAGGGATGGAGG - Intronic
909132104 1:71750511-71750533 AATCATGGCAGAAGGGAAGGAGG + Intronic
909180357 1:72416024-72416046 CATCATGGCGGAAGGCAAGGAGG - Intergenic
911107248 1:94143568-94143590 AATCACTGCTGGAGGGAAAGTGG + Intergenic
912080768 1:105932992-105933014 AATCACGGCAGAAGGGAAGGAGG - Intergenic
912450438 1:109764753-109764775 GAGCAGGGCAGGAGGGGAGGCGG + Intronic
912497264 1:110099691-110099713 CGGCAGGGAGGGAGGGAAGGAGG + Intergenic
912680616 1:111726797-111726819 GCTCAGGACTGAAGGGAAGGTGG - Exonic
912692909 1:111818217-111818239 CCTCTGGGCAGGAGGGAAGGAGG + Intronic
912955070 1:114149711-114149733 GATCAAGGCTGGAGTGATGGAGG + Intronic
913283750 1:117209360-117209382 GATCAAGGCTGGAGGAATGGTGG + Intronic
914931855 1:151942056-151942078 CATTAGGGCTGGAGGAAATAGGG + Intergenic
915022735 1:152796796-152796818 GAACAGAGCAGGAGGGAAGGAGG + Intronic
915327400 1:155087378-155087400 GCTCAGGGCTGGAAGGGAGGGGG - Exonic
915469916 1:156119729-156119751 CACCAGGGTGGGAGGGAGGGGGG - Intronic
916059642 1:161089668-161089690 CGCCAGGGAGGGAGGGAAGGAGG + Intergenic
916229920 1:162531492-162531514 CATCTGGGCTGGAGCGCAGTTGG - Intergenic
916482244 1:165225010-165225032 AATTAGGGATGGAGAGAAGGAGG + Intronic
916529038 1:165638430-165638452 CATCCGGGCTGGAGTGGAAGTGG - Intronic
916718260 1:167462758-167462780 CTTCAGGCCTGCAGGGAGGGAGG - Intronic
917278253 1:173353981-173354003 AATCAGGGCTGAATTGAAGGAGG + Intergenic
918969538 1:191396827-191396849 AATCAGGGCAGAAGGCAAGGAGG - Intergenic
919063161 1:192660920-192660942 TTTCAGAGCTGGAGGCAAGGTGG - Intergenic
919418452 1:197340936-197340958 AATCATGGCAGGAGGTAAGGAGG + Intronic
919741694 1:200984834-200984856 AAGCAGGGCTGGAGGGCAAGTGG - Intronic
919765497 1:201124678-201124700 CTGCAGGGCTGGAGGGGAGACGG + Intronic
919781630 1:201225002-201225024 CATCAAGCATGGAGGAAAGGTGG - Intronic
919926663 1:202194993-202195015 CCTCAGAGCTGGAGGGCTGGGGG + Intronic
920508302 1:206532517-206532539 CCTCAGGGAGAGAGGGAAGGGGG + Intronic
921422635 1:214966141-214966163 CTTAGGGGTTGGAGGGAAGGTGG + Intergenic
921794570 1:219327221-219327243 CCTCAGGGCTGGGTGGAATGGGG + Intergenic
921819447 1:219600599-219600621 CAGCAAGGCTGGAGGGGAGTGGG + Intergenic
922615953 1:226961362-226961384 CTTCAGGGCTGGAAGAGAGGAGG - Exonic
922884242 1:229005833-229005855 CATCAAGGCAGGAGGGTTGGGGG - Intergenic
923338947 1:232991774-232991796 CCTGAGGGCTGGAGGGGAGTGGG - Intronic
923538548 1:234871526-234871548 CAGCAGGGCTGGGGAGAAGCAGG - Intergenic
923905814 1:238382600-238382622 TATCAGGCTTTGAGGGAAGGTGG + Intergenic
924116529 1:240753177-240753199 CAGAAGGGAGGGAGGGAAGGAGG - Intergenic
924260782 1:242228643-242228665 AATGAGGGAGGGAGGGAAGGAGG + Intronic
924647227 1:245889445-245889467 CTTCAGGGCTGCAGGGTTGGTGG - Intronic
1062937777 10:1400940-1400962 CCTCAAGGCAGGAGGGAAGAAGG + Intronic
1062939841 10:1412979-1413001 CCTCAGGGCTGGCGGGAGGGTGG + Intronic
1063365357 10:5487136-5487158 GATTAGGACAGGAGGGAAGGTGG - Intergenic
1063849018 10:10163265-10163287 CATTAGAGCTGATGGGAAGGGGG + Intergenic
1064464751 10:15567828-15567850 CCTTAGGGCGTGAGGGAAGGTGG - Intronic
1065922224 10:30402765-30402787 GCTCAGGGCTGGAGGGAATGGGG - Intergenic
1067070670 10:43128791-43128813 CTCCAGGGCTGGAGGGGAAGAGG + Exonic
1067241969 10:44505248-44505270 TTGCAGGGCTGGAGGGTAGGGGG - Intergenic
1067457402 10:46429425-46429447 AATCACGGCGGGAGGCAAGGAGG + Intergenic
1067575247 10:47404573-47404595 CCTCAGCCCAGGAGGGAAGGAGG - Intergenic
1067629799 10:47955208-47955230 AATCACGGCGGGAGGCAAGGAGG - Intergenic
1067914669 10:50384473-50384495 AAGCAGGGATGGAGGGAAGGAGG - Intronic
1068080522 10:52313534-52313556 GATCAGGGGTGGAGGGAAGAGGG - Intergenic
1068726775 10:60311937-60311959 CTACAGGGCTGGAGGCAAGTAGG - Intronic
1068951180 10:62779149-62779171 CACAAGGGCTCGAGGGAAGTTGG + Intergenic
1069565126 10:69458917-69458939 CCTCCGGGCAGGAGGGCAGGTGG - Intronic
1069624810 10:69861101-69861123 CCTGAGGGCTGGTGGGACGGGGG - Intronic
1069671874 10:70212995-70213017 CATCAGGGACTGAGGGAAGGGGG + Intronic
1069813473 10:71179191-71179213 TAGCAGGGGTGGAGGGAAAGAGG - Intergenic
1069870920 10:71532435-71532457 CGTCAGGGGTGGAGGGGAGCTGG + Intronic
1069957228 10:72059678-72059700 CAGGCGGGCTGGAGTGAAGGGGG + Exonic
1071908524 10:90203020-90203042 CATCAGGGATGGAGAGAAGCAGG - Intergenic
1072050864 10:91701667-91701689 GAGCATGGCTGGAGGGCAGGTGG + Intergenic
1072673205 10:97446517-97446539 GCTCAGAGCAGGAGGGAAGGAGG + Intronic
1072710879 10:97714810-97714832 CCACGGGGCGGGAGGGAAGGGGG - Exonic
1073082958 10:100871444-100871466 GATGAGGGCCGGAGGGAGGGTGG - Intergenic
1073851215 10:107620554-107620576 AGTGAGGGATGGAGGGAAGGAGG - Intergenic
1074198221 10:111207947-111207969 CACCTGGGGTGGAGGGATGGGGG - Intergenic
1075090423 10:119441283-119441305 CATCTAGGCTGGAGGGATGGGGG + Intronic
1075180513 10:120206936-120206958 CAGTGGAGCTGGAGGGAAGGAGG - Intergenic
1075377630 10:121991874-121991896 AATCATGGCAGGAGGCAAGGAGG + Intronic
1075586047 10:123658975-123658997 CGCCCAGGCTGGAGGGAAGGGGG - Intergenic
1075605309 10:123801067-123801089 TATCAGGGAGGAAGGGAAGGTGG - Intronic
1075936109 10:126342896-126342918 GATGAGGGCTGGAGGGAGGGTGG + Intronic
1076194694 10:128508921-128508943 AATCATGGCTGAAGGCAAGGAGG - Intergenic
1076358134 10:129867591-129867613 CCCCAGGGCTGCAGGGCAGGGGG + Intronic
1076591613 10:131587448-131587470 CCTCAGGGCTGCAGTGGAGGGGG - Intergenic
1076802279 10:132836117-132836139 GAGCAGGGCTGCAGGGGAGGGGG - Intronic
1076995546 11:295881-295903 ACTCAGGGAGGGAGGGAAGGAGG + Exonic
1077077297 11:707442-707464 CAGCAGGGCAGGAGGGTAGAGGG - Intronic
1077118451 11:896013-896035 CGTCAGGGTGGGAGGGCAGGAGG - Intronic
1077214959 11:1391346-1391368 GGGCAGGGGTGGAGGGAAGGAGG + Intronic
1077217470 11:1400938-1400960 CAGCAGGGATGGAAGGAAGGAGG - Intronic
1077333916 11:1994966-1994988 CCTCAGGGGTGCAGGGCAGGCGG - Intergenic
1077457966 11:2692291-2692313 CAATAGGGATGGAGGGAAGCAGG - Intronic
1077499947 11:2904797-2904819 GAGCAGGGCTGGAAGGAAGCAGG + Intronic
1077549687 11:3194545-3194567 CAACATGGAAGGAGGGAAGGGGG - Intergenic
1077779277 11:5307674-5307696 AATGAGGGAAGGAGGGAAGGAGG - Intronic
1078064728 11:8070949-8070971 CAGGGGGGCTGGAGGGAAAGGGG + Intronic
1078337837 11:10477746-10477768 CAGCAGGGCTGGAGGCTGGGTGG + Intronic
1078386576 11:10898351-10898373 GATGAGGGCTGGAGAGGAGGAGG + Intergenic
1078406780 11:11077057-11077079 CAACAGTGCTGGAGTGAAAGAGG - Intergenic
1078438362 11:11344158-11344180 GGTCAGGGCTGGAGGGGTGGTGG - Intronic
1078450468 11:11437067-11437089 CATCAGGGCAGAGGGGAGGGAGG - Intronic
1078759264 11:14238658-14238680 GGTCAGGTCTGGAGGGAAGCGGG - Intronic
1079535479 11:21510104-21510126 CTTCAGGACTGTAGGGTAGGCGG + Intronic
1079591477 11:22188488-22188510 CACCATGGCTGGAGGGTAGTTGG + Intergenic
1080151337 11:29055890-29055912 AATCAGGGCAGAAGGCAAGGAGG - Intergenic
1080443099 11:32313428-32313450 CATCAGGGGTGTGGAGAAGGTGG - Intergenic
1080551493 11:33376673-33376695 CCTCAGGGCTCAAGGGAAGCTGG + Intergenic
1080851428 11:36073517-36073539 CTACAGGGCTGTGGGGAAGGGGG - Intronic
1081573856 11:44307464-44307486 CTTCAGGTCCAGAGGGAAGGCGG - Intronic
1081866236 11:46362092-46362114 GACCTGGGTTGGAGGGAAGGAGG - Intronic
1081869124 11:46375379-46375401 CACCAGGGCTGGGGGCAGGGGGG - Intronic
1081991377 11:47339409-47339431 GAACAGGGCAGGAGGGAAGTAGG + Intronic
1082835980 11:57650194-57650216 TGGCAGGGCTGGAGGAAAGGAGG + Intronic
1083034958 11:59628514-59628536 CAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1083075605 11:60033740-60033762 CTTGAGGGATGGAGGGTAGGAGG + Intergenic
1083090606 11:60195722-60195744 CTTCAGAGCTGGAGGTAAGGTGG + Intergenic
1083094250 11:60233354-60233376 CATCAAGGCTCCAGGGAAAGAGG - Intronic
1083259083 11:61513561-61513583 CATGAGGGTGGGTGGGAAGGGGG - Intergenic
1083377907 11:62241255-62241277 CATCACAGCAGGAGGGCAGGAGG + Intergenic
1083742604 11:64718802-64718824 CATCACGGCTGGAAGGAAGGGGG - Intronic
1083854154 11:65384120-65384142 CAGCAAGGCTGTAGGGAAGTGGG - Intergenic
1084014242 11:66369281-66369303 CAGTAGGGCTGGGGGGCAGGGGG + Intronic
1084305806 11:68282736-68282758 CCTCAGGGCTGGAGGCATGGAGG - Intergenic
1084424415 11:69076811-69076833 CACGAGGGCAGGAGGGCAGGTGG - Intronic
1084424425 11:69076844-69076866 CATGAGGGCAGGAGGGCAAGTGG - Intronic
1084424475 11:69077010-69077032 CAGGAGGGCAGGAGGGCAGGTGG - Intronic
1084424552 11:69077259-69077281 CAGGAGGGCAGGAGGGCAGGTGG - Intronic
1084424584 11:69077367-69077389 CAGGAGGGCAGGAGGGCAGGTGG - Intronic
1084545309 11:69812432-69812454 CAAGAGGGCTGGAGAGCAGGGGG - Intronic
1084575186 11:69984615-69984637 CAGCAGGCCTGGTGGGGAGGAGG + Intergenic
1084691000 11:70726508-70726530 GATCAGGGCTGGAACGGAGGTGG + Intronic
1085323919 11:75592331-75592353 CATTGGGGCTGCAGGCAAGGAGG - Intronic
1085523874 11:77153339-77153361 GAGCAGGGTTGGAGGGAAGGGGG + Intronic
1086049910 11:82577564-82577586 AAGCGGGGCTGGAGGGGAGGGGG + Intergenic
1086856111 11:91868060-91868082 CAGCAGGGCTGGGCAGAAGGAGG - Intergenic
1087838231 11:102896113-102896135 AATCATGGCTGAAGGCAAGGAGG - Intergenic
1087970217 11:104471763-104471785 TGCCAGGGCTTGAGGGAAGGAGG + Intergenic
1088865699 11:113845612-113845634 CACCAGGGCTAGAGGGCAGTAGG + Intronic
1089126032 11:116177362-116177384 CCTCAGAGATGGAGGGAAGGGGG - Intergenic
1089180651 11:116580931-116580953 CGTGAGGGCTGGCGGGGAGGAGG - Intergenic
1089214954 11:116829700-116829722 CATCTGGGCTGCAGGGCTGGCGG + Intronic
1089300787 11:117497625-117497647 CACCGCTGCTGGAGGGAAGGAGG - Intronic
1089495721 11:118907856-118907878 AATTAGGGCTGGAGGGGAGGGGG + Intronic
1089698237 11:120228827-120228849 GATCAGGGAGGGAGGGAGGGAGG - Intronic
1090188341 11:124752321-124752343 AATCGGGGCTGGAGGAGAGGAGG - Intergenic
1090626911 11:128615921-128615943 AATCAACCCTGGAGGGAAGGGGG + Intergenic
1091334905 11:134759046-134759068 CCTCAGGCCTGGAGGGGAAGTGG - Intergenic
1202816899 11_KI270721v1_random:50148-50170 CCTCAGGGGTGCAGGGCAGGCGG - Intergenic
1091374280 12:15843-15865 ACTCAGGGCTGGAGGGGAGGAGG + Intergenic
1091693422 12:2612047-2612069 CATCAGGGGTGGACAGAACGGGG + Intronic
1091806365 12:3359337-3359359 AGGCAGGGCAGGAGGGAAGGAGG - Intergenic
1092001001 12:5032289-5032311 CATCAGGGTTGGAGGCAGTGAGG + Intergenic
1092163321 12:6327946-6327968 CGTAAGTGCTGGAGGGAAGCTGG + Exonic
1092261140 12:6953878-6953900 CCGCAGGGATGGGGGGAAGGAGG - Intronic
1094423758 12:30298359-30298381 CTTCAGAGCTGGAGTGAGGGTGG - Intergenic
1095808344 12:46345334-46345356 TATCAGGGCTGAGGGGAAGGGGG + Intergenic
1096501947 12:52069660-52069682 CATAGAGACTGGAGGGAAGGAGG - Intronic
1096512095 12:52136362-52136384 CCCCAGGGCTCGAGTGAAGGTGG + Intergenic
1096521318 12:52186299-52186321 CCTCAGTGCTGGAGGGAAGAGGG - Intronic
1096571406 12:52525437-52525459 GATCATGGGTGGGGGGAAGGTGG + Intergenic
1096571416 12:52525479-52525501 GATCATGGGTGGAGGGCAGGTGG + Intergenic
1097086421 12:56471707-56471729 CATGGTGGCTGGAGGGTAGGTGG + Exonic
1099005783 12:77233252-77233274 TATCAGGGATGGAGGGAGGAAGG - Intergenic
1099560345 12:84165234-84165256 CATTATGGCTAGAGTGAAGGAGG + Intergenic
1099746090 12:86707018-86707040 CATCATGGCAGAAGGCAAGGAGG - Intronic
1100587870 12:95996148-95996170 CAGCAGGTCTGGATGGAAAGTGG - Exonic
1101901099 12:108791851-108791873 CATCAGGGGTGTGGGGAAGTGGG + Intronic
1101993720 12:109509417-109509439 CATCAGGGGTAGGGGGAAAGGGG - Intronic
1102375964 12:112421116-112421138 TACCAGGGCTGGAGGGGAGAAGG - Intronic
1102745335 12:115244417-115244439 CACCAGGGCTGGGGAGCAGGAGG + Intergenic
1103025835 12:117573178-117573200 AATCGGAGCAGGAGGGAAGGGGG + Intronic
1103155373 12:118680251-118680273 CGTGAGGGGTGGACGGAAGGGGG + Intergenic
1103536762 12:121638804-121638826 CATGAGGGCTGGAGGGACAGGGG - Intronic
1104320633 12:127747639-127747661 CCTCAGGGAGGGAGGGAGGGAGG - Intergenic
1104516483 12:129431809-129431831 CAACAGGGCATGAGGGGAGGTGG - Intronic
1104519287 12:129458029-129458051 CATCAGAGCTGGAGGCCTGGAGG - Intronic
1104558344 12:129822203-129822225 GAGCAGGGCTGGAGGGGAGAAGG + Intronic
1105012389 12:132764430-132764452 CCTCAGAGCGGGACGGAAGGTGG + Intergenic
1105249564 13:18685734-18685756 CATCAGTCCTGTAGGGATGGGGG - Intergenic
1105756645 13:23471012-23471034 CAACAGGGTTGGAGGGAGGGAGG + Intergenic
1106159973 13:27192670-27192692 AATCATGGCTGAAGGCAAGGAGG - Intergenic
1106568583 13:30907032-30907054 CATCAGGACTGGGGGCGAGGGGG + Intronic
1106576128 13:30977472-30977494 AATCAGGGTTTGAGGGGAGGAGG - Intergenic
1107095905 13:36534935-36534957 TACCAGGGCTGGAGAGAGGGTGG - Intergenic
1107627660 13:42306336-42306358 CATGAGGGTGGGAGGAAAGGGGG - Intronic
1108463545 13:50692162-50692184 CAACACGGCTGGAGGTAAAGAGG - Intronic
1108482310 13:50886426-50886448 GTTCAGGGATGGAGGGAAGAGGG + Intergenic
1108554932 13:51583482-51583504 GTTCAAGTCTGGAGGGAAGGAGG + Intergenic
1109390300 13:61683564-61683586 AATCATGGCAGAAGGGAAGGAGG - Intergenic
1110385434 13:74905479-74905501 TGCCAGAGCTGGAGGGAAGGAGG + Intergenic
1110515591 13:76408585-76408607 CATGAGTGTTGGAAGGAAGGAGG + Intergenic
1111834262 13:93368316-93368338 AAGCAGGGAGGGAGGGAAGGAGG - Intronic
1111985373 13:95060905-95060927 CACCAGGGGCTGAGGGAAGGTGG - Intronic
1112339278 13:98538969-98538991 AGTCAGGGCTGGTGGGGAGGGGG + Intronic
1112743754 13:102504621-102504643 AATAAGGTTTGGAGGGAAGGGGG + Intergenic
1112946217 13:104930162-104930184 AATCATGGCAGGAGGCAAGGAGG - Intergenic
1113050996 13:106212010-106212032 CATCAAGGTTGGAGGGAGTGAGG - Intergenic
1113146044 13:107208835-107208857 AATAAGGGAAGGAGGGAAGGAGG - Intronic
1113429990 13:110241322-110241344 CAGCAGGGCTGGAGCCAAGTTGG - Intronic
1113595973 13:111533188-111533210 CATCTAGGCTGGAGAGAATGTGG - Intergenic
1113677029 13:112214639-112214661 GGTGAGGGCTGGAGGGGAGGAGG + Intergenic
1113677091 13:112214833-112214855 GGTGAGGGCTGGAGGGGAGGAGG + Intergenic
1113910740 13:113840088-113840110 CAGCAGGCCTGGACGCAAGGTGG + Intronic
1113938225 13:114006141-114006163 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938260 13:114006251-114006273 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938321 13:114006437-114006459 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938381 13:114006623-114006645 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938429 13:114006771-114006793 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938464 13:114006881-114006903 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938499 13:114006991-114007013 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938534 13:114007103-114007125 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938630 13:114007380-114007402 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938653 13:114007452-114007474 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1114345815 14:21793678-21793700 CATCAGGTGTGGAGGGTAGATGG + Intergenic
1114663927 14:24367728-24367750 CCTCAGGCTTGGAGGGAAAGGGG + Intronic
1114687425 14:24547462-24547484 CATCATGGCGGAAGGCAAGGAGG + Intergenic
1114854317 14:26419647-26419669 CATCAGGGCTGAAAGGAATCAGG + Intergenic
1114935338 14:27529284-27529306 AATCATGGCTGAAGGCAAGGAGG - Intergenic
1115772250 14:36676537-36676559 CAGAAGGGTTGGAGGGCAGGAGG - Exonic
1115831775 14:37350708-37350730 GTTGAGGGCTGGAGGGAAGTGGG - Intronic
1117652765 14:57924097-57924119 AATCATGGCTGAAGGCAAGGAGG - Intronic
1117701377 14:58417143-58417165 AATCATGGCTGAAGGCAAGGAGG - Intronic
1117818671 14:59625077-59625099 TATAAGGGAGGGAGGGAAGGAGG + Intronic
1117878305 14:60279810-60279832 AATCAGAGCTGGCGGCAAGGAGG + Intronic
1117913843 14:60657255-60657277 CGTCGGGGCTTGAGGGAAGAGGG + Intronic
1118593508 14:67419039-67419061 CATCAGGGCTGGGGTGGAGCAGG + Intergenic
1118722620 14:68605042-68605064 CTTGAGGGCTGGAGCGAGGGAGG - Intronic
1119004913 14:70915906-70915928 CCTCAGAGCAGGAAGGAAGGAGG + Intronic
1119027997 14:71168969-71168991 CCCCAGGGCTGGAGGGAAAAAGG - Intergenic
1119353544 14:73986622-73986644 CATGAGGGCTGGGTGGAAGAAGG - Intronic
1120188442 14:81418190-81418212 AATCATGGCAGAAGGGAAGGAGG + Intronic
1120526130 14:85579100-85579122 CAACAGGGCTGGCAGAAAGGAGG - Intronic
1121098267 14:91233044-91233066 CTTCAAGGCTGGGGGGAAGAGGG + Exonic
1121826126 14:97010973-97010995 GAGCAGGCTTGGAGGGAAGGGGG + Intergenic
1122907851 14:104810444-104810466 CAACAGGTCGGGAAGGAAGGTGG + Intergenic
1122970501 14:105150291-105150313 CCTCGGGACTGGAGGGCAGGGGG - Intronic
1122985016 14:105208055-105208077 CACAATGGCTGGAGGGGAGGTGG - Intergenic
1123040296 14:105487602-105487624 CCGCAGGGCTGGAAGGAACGCGG + Intronic
1123097487 14:105773385-105773407 AAGCAGGGCTGGTGGGAAGCAGG - Intergenic
1123144296 14:106112993-106113015 CATCAGGGGTGGGAGGAAGGGGG + Intergenic
1124598422 15:31110906-31110928 CAGAAGGGAGGGAGGGAAGGGGG - Intronic
1125042953 15:35213488-35213510 CATCAGGTCTAGTGGGGAGGTGG - Intergenic
1125745215 15:41993018-41993040 GACCCGGGCAGGAGGGAAGGTGG + Intronic
1125745958 15:41997252-41997274 TCTCAGGGCTGGAGGGAGAGAGG + Exonic
1125768989 15:42152859-42152881 CATCCAGGATGGAGGGAGGGAGG + Intronic
1126416695 15:48425200-48425222 CTCCTGTGCTGGAGGGAAGGAGG - Intronic
1127532012 15:59852595-59852617 CAGCAGGGCTGGAAGGAACATGG + Intergenic
1127797687 15:62452600-62452622 GCCAAGGGCTGGAGGGAAGGAGG - Intronic
1128112448 15:65085313-65085335 CGTCTGCGCAGGAGGGAAGGGGG - Intergenic
1128324007 15:66711800-66711822 CCTCAGGGCTGGAGGGCTGGAGG + Intronic
1128380312 15:67107465-67107487 CAGGAGGGCAGGAGGGCAGGAGG - Intronic
1128725036 15:69982128-69982150 AACCTGGCCTGGAGGGAAGGAGG + Intergenic
1129393263 15:75231143-75231165 GGTTAGGGCAGGAGGGAAGGTGG - Intergenic
1129403760 15:75301087-75301109 TATCTGGGAGGGAGGGAAGGGGG + Intergenic
1129491452 15:75929999-75930021 CATCTTGGCTGGAGGCCAGGTGG + Exonic
1129569862 15:76669762-76669784 CAGCATGGCGGGAGGGAATGTGG - Intronic
1129856742 15:78830426-78830448 AAGCAGGGCTGGCGGGCAGGGGG + Intronic
1130079730 15:80722059-80722081 TAACAGGGCTGCAGGGAAGATGG - Intronic
1130135954 15:81182142-81182164 CAACTGGGCTCGGGGGAAGGTGG - Intronic
1130258772 15:82338326-82338348 CAGAAGGGCGGGAGGGATGGCGG - Intergenic
1130269912 15:82440777-82440799 CAGAAGGGCGGGAGGGATGGCGG + Intergenic
1130326201 15:82882278-82882300 CCACAGGCCTGGAGAGAAGGTGG + Intronic
1130462248 15:84168078-84168100 CAGAAGGGCGGGAGGGATGGCGG + Intergenic
1130473868 15:84247000-84247022 CAGAAGGGCGGGAGGGATGGCGG + Intergenic
1130481282 15:84361064-84361086 CAGAAGGGCGGGAGGGATGGCGG + Intergenic
1130490426 15:84426695-84426717 CAGAAGGGCGGGAGGGATGGCGG - Intergenic
1130502016 15:84505465-84505487 CAGAAGGGCGGGAGGGATGGCGG - Intergenic
1130596151 15:85251615-85251637 CAGAAGGGCGGGAGGGATGGCGG + Intergenic
1130884913 15:88084698-88084720 CTACTGGGCTGGAGGGCAGGGGG - Intronic
1131578264 15:93614023-93614045 CACAAGGGCTGGAGGAGAGGAGG + Intergenic
1132022225 15:98372582-98372604 CACCAGGACTGGAGGGCAAGTGG - Intergenic
1132231080 15:100184731-100184753 CATGATGGACGGAGGGAAGGTGG - Intronic
1132452318 15:101975213-101975235 ACTCAGGGCTGGAGGGGAGGAGG - Intergenic
1132454578 16:15410-15432 ACTCAGGGCTGGAGGGGAGGAGG + Intronic
1132745623 16:1435009-1435031 CAGCAGGGCAGGCGGGGAGGCGG + Intronic
1132799458 16:1744507-1744529 GCTCAGGGCTGGAGAGAGGGTGG + Intronic
1132885431 16:2180190-2180212 CATCGGGCCTGGCGGGGAGGTGG - Exonic
1132890806 16:2203658-2203680 CATCAGAGCTGGAGACAGGGTGG + Intergenic
1132971978 16:2693610-2693632 GATGAAGGCAGGAGGGAAGGAGG - Intronic
1133346023 16:5071029-5071051 CATCATGGCAGAAGGCAAGGAGG - Intronic
1133542505 16:6770062-6770084 AATCAGAGCTGGAGGCAAAGTGG + Intronic
1133817946 16:9212492-9212514 GAACATGGCTGGAGGGCAGGGGG + Intergenic
1134326761 16:13214687-13214709 AATCAGGGCAGAAGGGAAGGAGG + Intronic
1134779848 16:16885784-16885806 CATCAGGGCTGTAGCTACGGAGG - Intergenic
1135522582 16:23188916-23188938 AATCTGTGCTGGGGGGAAGGAGG - Intronic
1135565849 16:23510405-23510427 CGTCGGGGCTGGAGCGATGGCGG - Exonic
1135635355 16:24071082-24071104 CATCAGCCCTGGAGTGGAGGGGG - Intronic
1135740320 16:24969713-24969735 CTTCCAGGCTGGAGGGAAGGAGG + Intronic
1135752330 16:25067117-25067139 CCCCAGGGCTGGCGGGGAGGCGG - Intergenic
1135790231 16:25387622-25387644 CATCAAGGCTGTGGGCAAGGGGG - Intergenic
1136405071 16:30040545-30040567 CATGAGGGGAGGAGAGAAGGTGG + Intronic
1136547906 16:30965777-30965799 CATCAGGTCTGGGTGGGAGGAGG - Exonic
1136580269 16:31147385-31147407 CATCAGGGCAGGAGGTGATGAGG - Intronic
1136605780 16:31332333-31332355 CATCAGCGCTGGTGTGGAGGAGG - Exonic
1136775656 16:32870494-32870516 CCTCAGTGCTGGAGAGGAGGTGG + Intergenic
1136894961 16:33991018-33991040 CCTCAGTGCTGGAGAGGAGGTGG - Intergenic
1137236769 16:46623962-46623984 CTTCTGGGGTGGAGGGACGGGGG + Intergenic
1137267854 16:46883909-46883931 CACCAGAGCTGGCAGGAAGGCGG - Intergenic
1137496263 16:48971587-48971609 GATCAGGGCTGGCAGGAGGGAGG - Intergenic
1138548118 16:57731382-57731404 AAACAGGGCTGTAGGGGAGGTGG - Exonic
1138635100 16:58331957-58331979 CACCAGGGATTGGGGGAAGGTGG - Intronic
1138700279 16:58855575-58855597 CATCAGGCGGGGAGGAAAGGTGG - Intergenic
1139313934 16:66051366-66051388 CATTTGGGCTGGAGGGAGGGAGG + Intergenic
1139657557 16:68398036-68398058 CGTCAGGGAGGGAGGGAGGGAGG + Intronic
1140327115 16:74015198-74015220 CATCATGGCAGAAGGCAAGGAGG - Intergenic
1141000028 16:80299288-80299310 CAACGGGGCAGGAGGGAAAGAGG + Intergenic
1141039553 16:80661165-80661187 CTTCAGGCCTGGAGGAAGGGAGG + Intronic
1141052543 16:80784786-80784808 GATCAGTGCTGGAGAGAAGCTGG + Intronic
1141223738 16:82095386-82095408 TATCAGGACTGCAGAGAAGGAGG - Intronic
1141435230 16:83996112-83996134 CCTCTGGGCTGGAAGGATGGAGG + Intronic
1141464539 16:84197080-84197102 AACTGGGGCTGGAGGGAAGGAGG + Exonic
1141579136 16:84985223-84985245 CATCAGGGCTGACTGGAAGTGGG - Intronic
1141632194 16:85294184-85294206 GCTCTGGGGTGGAGGGAAGGAGG - Intergenic
1141888147 16:86907341-86907363 ATTTAGGGCTGGAGGGAGGGTGG - Intergenic
1141961223 16:87410752-87410774 CAGCAGGCCTGCAGGCAAGGTGG - Intronic
1142194956 16:88735083-88735105 CATCAGGGCGGGCAGGCAGGAGG + Intronic
1142309494 16:89304067-89304089 CAGCAGGGCTGTAGAGAAGCTGG + Intronic
1142411928 16:89921350-89921372 CATCATGGCTGGAGGGACTCAGG - Intronic
1203078074 16_KI270728v1_random:1132603-1132625 CCTCAGTGCTGGAGAGGAGGTGG + Intergenic
1142500917 17:332483-332505 CATCAGGAAGGGAGGGAAGGAGG - Intronic
1142677260 17:1521460-1521482 CATCATTACTAGAGGGAAGGAGG + Intronic
1143178138 17:4968229-4968251 CCTCAGGGCCGAAGGGGAGGTGG - Exonic
1143252521 17:5533804-5533826 CATCAGGGGCAGAGGGATGGAGG + Intronic
1143437434 17:6939739-6939761 TAGCAGGGCTGGAGGGAGAGTGG + Intronic
1143508574 17:7383213-7383235 AATCAGGGCTGGAGTGGAGGTGG - Intronic
1143705354 17:8693880-8693902 CATCCAGGCTGGAGGGTAGTGGG - Intergenic
1144204683 17:12971760-12971782 CACCAGGGATGGAGGGAAAGGGG - Intronic
1144577380 17:16437567-16437589 CAACAGAGGTGGAGGGGAGGAGG - Intergenic
1144645667 17:16971979-16972001 CAGGAGGGCAGGAGGGCAGGTGG - Intronic
1144952166 17:19000213-19000235 CACTAGGGCTGGAGGGAGGCTGG + Intronic
1145011559 17:19371145-19371167 CAGCAGCACTGGAGGGAGGGAGG + Intronic
1145185233 17:20788149-20788171 CCCCAGTGCTGGAAGGAAGGAGG + Intergenic
1145254790 17:21316634-21316656 AATGAGGGAGGGAGGGAAGGGGG + Intergenic
1145321810 17:21771331-21771353 AATGAGGGAGGGAGGGAAGGGGG - Intergenic
1145352606 17:22098843-22098865 CAGAAGGGCTGGAGGGAATTAGG + Intergenic
1145796508 17:27658678-27658700 GATCAGGGCTGGTGGGCAGTGGG - Intergenic
1145810943 17:27763953-27763975 GATCAGGGCTGGTGGGCAGTGGG - Intronic
1146152249 17:30484715-30484737 CATCAGGGCTGCATTCAAGGAGG - Exonic
1146280732 17:31542457-31542479 CATCAGGGCTGGAAGGAACGTGG + Intergenic
1146528235 17:33585061-33585083 TCTCTAGGCTGGAGGGAAGGAGG - Intronic
1146631028 17:34469385-34469407 CATTAGGGTTGGAGGGAAGCTGG - Intergenic
1146822555 17:35996057-35996079 CAGGAGGGAGGGAGGGAAGGGGG + Intronic
1146963294 17:37003514-37003536 CACCAGGGCTGGAGTGCAGTGGG + Intronic
1147051716 17:37800083-37800105 CATCAGGGCCTGTGAGAAGGTGG + Intergenic
1147120087 17:38330674-38330696 CAGCAGAGCTGGAGCCAAGGTGG + Exonic
1147807865 17:43144936-43144958 CATCCTGGCAGCAGGGAAGGTGG - Intergenic
1147914157 17:43876853-43876875 CATCAGGGCTGCTGGGTTGGAGG - Intronic
1148215101 17:45830009-45830031 CATCTGGGCTGGGGTGATGGAGG + Intronic
1148462415 17:47846334-47846356 CCTCAGGGATGGAAGGAAGAGGG - Exonic
1148864217 17:50620155-50620177 CTTAGGGGGTGGAGGGAAGGAGG + Intronic
1148921060 17:51034607-51034629 AAACTGGACTGGAGGGAAGGAGG + Intronic
1149555926 17:57573579-57573601 CAGCAGGTCTGGAGTGATGGGGG - Intronic
1149565883 17:57640127-57640149 CATCAGGGCAGGAGGGCACTGGG + Intronic
1149734647 17:58981279-58981301 CATGAAGGATGGTGGGAAGGGGG - Exonic
1150228651 17:63538050-63538072 CATCAGGGCTGGGGGCGGGGCGG - Exonic
1150645443 17:66974948-66974970 CGTCAGGGTGGGAGGGAGGGAGG - Intronic
1151466503 17:74289163-74289185 CAGCAGGGCTGGAGGGCAACAGG - Intronic
1151469470 17:74309213-74309235 CATCATGGTTGGAGGGACAGAGG - Intronic
1151678000 17:75609707-75609729 CATCAGGAAGGGAGGGAGGGAGG - Intergenic
1151690982 17:75685165-75685187 CATCTGGCCCGAAGGGAAGGAGG - Intronic
1151785149 17:76271777-76271799 CTGCAGGGCTGCGGGGAAGGGGG - Intergenic
1152014551 17:77741861-77741883 CATCAGGGATGGAGGGAGACTGG - Intergenic
1152098431 17:78286686-78286708 CAGCAGCCCTGGAGAGAAGGAGG + Intergenic
1152224240 17:79085399-79085421 CCCCAGAGCTGGAGGGATGGAGG + Intronic
1152351327 17:79785473-79785495 CTCCAGGGCTGAAGGCAAGGTGG - Exonic
1152566616 17:81103210-81103232 CATCAGGGCCTGGAGGAAGGAGG - Intronic
1152620183 17:81359485-81359507 AATGAGGGAGGGAGGGAAGGAGG - Intergenic
1152626052 17:81388441-81388463 CTCCAGGGCTGGAGGGCAGGTGG + Intergenic
1152778721 17:82217130-82217152 CCTGAGGGCTGGAGGCAGGGAGG + Intergenic
1152934089 17:83125958-83125980 CGTCAGGGCTGGAGTCAAGCTGG - Intergenic
1153736434 18:8073862-8073884 CATCCGGGCTGGAGTGCAGTGGG - Intronic
1154207486 18:12350050-12350072 CATCTGGGCTGGAGTGCAGTGGG + Intronic
1154439265 18:14373157-14373179 CATCAGTCCTGTAGGGATGGGGG + Intergenic
1155340007 18:24804261-24804283 CAAGAGGGCTGCCGGGAAGGTGG - Intergenic
1155772654 18:29722299-29722321 AATCATGGCTGAAGGCAAGGAGG + Intergenic
1156293193 18:35767323-35767345 CTTTAGGGCTGGAGGGTTGGGGG - Intergenic
1157288672 18:46394502-46394524 CAGCCTGGCTGGGGGGAAGGTGG - Intronic
1157544676 18:48539445-48539467 GAGCAGGGATGGGGGGAAGGGGG - Intronic
1157576684 18:48748423-48748445 TCTCAGGGCTGGAGTGAAGGTGG - Intronic
1157736827 18:50057201-50057223 CATCACAGCTGGATGGATGGTGG - Intronic
1158297055 18:56009971-56009993 AATCATGGCAGGAGGCAAGGAGG + Intergenic
1158580910 18:58681958-58681980 CAGCAGTGGTGGAGGGCAGGAGG + Intronic
1158768410 18:60484661-60484683 CATCTGGGCTGGAGGGTTTGAGG - Intergenic
1159008851 18:63039592-63039614 CATCCAGGCTGGAGGGCAGTGGG + Intergenic
1159283244 18:66314476-66314498 TGTCAGAGATGGAGGGAAGGAGG - Intergenic
1159771230 18:72547344-72547366 CAGAAGGGCAGGAGGGTAGGAGG + Intronic
1159905181 18:74083339-74083361 CAGCAGGGCTCGACGGAAGCAGG + Intronic
1160174096 18:76579119-76579141 CCTGAGGGCTGGAGGGGACGAGG + Intergenic
1160359753 18:78264074-78264096 CATCATGGCTGCAGGTAATGAGG - Intergenic
1160396425 18:78575694-78575716 CAGCTGGGCTAGAGGGGAGGGGG - Intergenic
1160429846 18:78803875-78803897 CCTCAGGGCTTCAGGGCAGGAGG + Intergenic
1160669175 19:348675-348697 AAGCAGGGCTGGAGGGAGGGAGG - Intergenic
1160709610 19:544966-544988 GATGACGGGTGGAGGGAAGGAGG - Intronic
1160807266 19:997615-997637 CACCTGGGCTGGAGTGCAGGGGG - Intronic
1160888181 19:1362044-1362066 CAAGAGGGAAGGAGGGAAGGAGG - Intronic
1160969730 19:1762256-1762278 CAGGAGGGCAGGAGGGCAGGAGG - Intronic
1161136783 19:2624742-2624764 CTTCTGGGAAGGAGGGAAGGAGG + Intronic
1161504649 19:4637356-4637378 CATCAGGGCAGGAGGACTGGAGG - Intergenic
1161615797 19:5269508-5269530 GCTCAGGGCTGGTGGCAAGGTGG + Intronic
1161636110 19:5390238-5390260 CGTAAGGGCTGGTGGGGAGGGGG + Intergenic
1162023292 19:7878815-7878837 CTCCAGGCCTGCAGGGAAGGAGG + Intergenic
1162479653 19:10921008-10921030 CGTCAGGGCTGGAGGCAGAGGGG - Intronic
1162589835 19:11584221-11584243 CTTGGGGGCTGCAGGGAAGGGGG + Intronic
1162725164 19:12685896-12685918 CACCAGGGCTGGAGTGCAGTGGG + Intergenic
1163038101 19:14583291-14583313 GACCAGGGCTTGAGGGATGGAGG + Intronic
1163038790 19:14587548-14587570 GACCAGGGCTTGAGGGATGGAGG + Intronic
1163039536 19:14592215-14592237 GACCAGGGCTTGAGGGATGGAGG + Intronic
1163400880 19:17091767-17091789 AGCCAGGGCTGCAGGGAAGGGGG - Intronic
1163424950 19:17236091-17236113 CATGGGGGCGGGAGGGGAGGCGG + Intronic
1163578325 19:18123443-18123465 GGTCAGGGCTGGGGTGAAGGAGG - Intronic
1163738681 19:18997326-18997348 CCTCAGGTCAGGAGGGAGGGAGG + Intronic
1163796114 19:19338955-19338977 TAACAGAGCAGGAGGGAAGGAGG - Intronic
1163860201 19:19738824-19738846 ACTCAGGGATGGAGGCAAGGAGG - Intergenic
1164512910 19:28911989-28912011 CTTCCAGGCTAGAGGGAAGGAGG - Intergenic
1164551679 19:29217495-29217517 CATCAAGGCAGTAGGGAAGAGGG - Intergenic
1164975646 19:32571012-32571034 AATGAGGGAGGGAGGGAAGGAGG - Intergenic
1165349108 19:35267094-35267116 ACTCATGGCTGCAGGGAAGGGGG - Exonic
1165792354 19:38499893-38499915 CACCAAAGCTGCAGGGAAGGTGG - Exonic
1166409850 19:42549295-42549317 AATCATGGCAGAAGGGAAGGAGG - Intronic
1166689671 19:44814818-44814840 CTTCAGGGCTGTAGGGAGGAGGG - Intronic
1167477671 19:49710327-49710349 CCTCAGGGCTAGAGAGATGGAGG - Exonic
1167499527 19:49837273-49837295 CGTCAGGCTGGGAGGGAAGGAGG + Intronic
1167710270 19:51106180-51106202 CATCAAGGCTGAAGGAGAGGAGG - Intronic
1167854835 19:52229086-52229108 CATCAGGGCTGGAGGGAAGGAGG + Exonic
1167978253 19:53250665-53250687 TATCAGGGATGGAGGGTGGGAGG + Intronic
925203519 2:1988106-1988128 CAGCTGGGCTGGCGGGAGGGTGG - Intronic
925203533 2:1988159-1988181 CAGCTGGGCTGGCGGGAGGGTGG - Intronic
925339043 2:3121565-3121587 CATCCAGGCTGGAGTGAAAGCGG - Intergenic
926359159 2:12068833-12068855 AATAAAGGCTGAAGGGAAGGGGG + Intergenic
927089888 2:19702312-19702334 CATCAGGGTTGCATGGAAGTAGG + Intergenic
927194685 2:20539375-20539397 CACTAGGGCAGGAGGGGAGGTGG + Intergenic
927435550 2:23063266-23063288 CCTGAGGGCTGGAAGGAAGTTGG - Intergenic
927646434 2:24879888-24879910 CATCTGGGCAGGTGGGAAGGAGG + Intronic
927653788 2:24928655-24928677 CAGCAGTACTGGAGGGGAGGCGG + Intergenic
927672247 2:25078578-25078600 CAGCAGGGCTGGAGGGAAGCTGG - Intronic
927877879 2:26670818-26670840 CCTGAGGGAGGGAGGGAAGGAGG + Intergenic
928055577 2:28050811-28050833 TTTCAAGGCTGGAGGGGAGGAGG + Intronic
928424472 2:31166707-31166729 GATGAGGGCTGGTGGGAAGGGGG + Intergenic
930108490 2:47658335-47658357 CTCCAGGTCTGGAGGGGAGGCGG - Intergenic
931226892 2:60339507-60339529 CATGATGGGTGGAGGGCAGGTGG - Intergenic
931768165 2:65475207-65475229 CATGTGAGCTGGAGGGGAGGTGG + Intergenic
932030408 2:68177865-68177887 CATCTGGGCTGGAGTGCAGTGGG - Intronic
932049935 2:68388294-68388316 CCTCATGGCTGGAGGGGAGGGGG + Intronic
932122318 2:69113180-69113202 CAGCAGGACTAGGGGGAAGGTGG - Intronic
932374762 2:71226407-71226429 AATGAGGGCTGGAGTCAAGGGGG + Intronic
932693434 2:73933278-73933300 GAACAGTGATGGAGGGAAGGAGG - Intronic
932897369 2:75654156-75654178 CATCTTGGATGCAGGGAAGGAGG - Intronic
933779845 2:85794053-85794075 TATCAGGGCTGGGGGGAGGCAGG - Intergenic
934477563 2:94603528-94603550 CCTGAGGGGTGGAGGGCAGGGGG - Intronic
934540956 2:95174642-95174664 CAGCAGGGAGGGATGGAAGGAGG - Intronic
935291893 2:101618036-101618058 CAACAGGGCTGCAGGAAACGGGG + Intergenic
935449305 2:103190551-103190573 CAACAGGGGTGGAGGAAATGTGG - Intergenic
936096582 2:109534920-109534942 AAGCAGTGCTGGAGGGGAGGGGG - Intergenic
936568534 2:113597686-113597708 ACTCAGGGCTGGAGGGGAGGAGG - Intergenic
937358496 2:121213042-121213064 CATCATGGCTGGGGGGGAGGGGG + Intergenic
937914311 2:127091519-127091541 AATCAAGGCTGGAGGAAAGTTGG + Intronic
938240266 2:129737934-129737956 CAGGAGGGCAGGAGGGCAGGAGG - Intergenic
938371258 2:130769757-130769779 CACCAGGGCTGGAGAAAAGGAGG - Intergenic
938648596 2:133356438-133356460 CAGCAGAGCTGTAGGGAAAGTGG - Intronic
938860583 2:135364091-135364113 AAGGAGGGCAGGAGGGAAGGAGG + Intronic
939103665 2:137924975-137924997 CATCAGGCCTGTAGGGATGGGGG - Intergenic
939244517 2:139606454-139606476 CATGGGGGGTGGAGGGAGGGGGG + Intergenic
939480593 2:142742832-142742854 CATTGGGGGTGGAGGGAGGGGGG - Intergenic
940205523 2:151197643-151197665 AATCACGGCTGAAGGCAAGGAGG + Intergenic
941504911 2:166330632-166330654 TTTCAGGGCAGCAGGGAAGGAGG + Intronic
942308599 2:174633046-174633068 TATCAGGTTTGGAGGGATGGAGG - Intronic
943550481 2:189332650-189332672 CATCATGGCAGAAGGCAAGGAGG - Intergenic
943704026 2:191016029-191016051 AATCATGGCGGGAGGCAAGGAGG + Intronic
943732510 2:191317623-191317645 AATGTGGGGTGGAGGGAAGGGGG - Intronic
943741148 2:191410440-191410462 CTTCAGGGATGGAGTGAAAGGGG + Intronic
945459632 2:210090576-210090598 CACCAAGGCTGGAGGGCAAGTGG + Intronic
945958226 2:216105963-216105985 CAAGAGGGAGGGAGGGAAGGAGG + Intergenic
946159355 2:217826673-217826695 CTCCAGGATTGGAGGGAAGGAGG - Intronic
946279959 2:218659561-218659583 CTTCAGGGCTGGAGTGGGGGTGG - Intronic
946435062 2:219645966-219645988 GCTCAGAGCTGGTGGGAAGGTGG + Intergenic
946448575 2:219760837-219760859 CATCATGGCTGGAGGAAGGAAGG - Intergenic
947789981 2:232860001-232860023 CATCAAGGCGGGGGGGGAGGGGG - Intronic
948139339 2:235661249-235661271 GTTGAGGGCTGGAGGGAGGGAGG + Intronic
948266361 2:236637939-236637961 GATCTGGGGAGGAGGGAAGGAGG - Intergenic
948931946 2:241137535-241137557 CAGCAGGGAGGGAGGGAGGGAGG + Intronic
949041777 2:241852931-241852953 GAGCAGGGCTGGGGAGAAGGTGG + Exonic
1168798523 20:628643-628665 CATCAGGGATGGAGGGGACTGGG - Intergenic
1169074618 20:2752952-2752974 ACTCAGGGCTCGAGGGAAGCCGG + Intronic
1169221256 20:3824369-3824391 CATCAGAGCTGCTGGGTAGGAGG - Exonic
1169359904 20:4939194-4939216 CACCAGGGGTGGAGGTAAGATGG - Intronic
1169562292 20:6814663-6814685 TATCAGGGTTGGAGAGGAGGTGG - Intergenic
1169830593 20:9820935-9820957 TATCAGGGCTGGAGGAAGAGTGG - Intronic
1170450479 20:16478333-16478355 CAACCGGGCTGCAGGGCAGGTGG + Intronic
1170604944 20:17868973-17868995 CATCAGGGGTGGCGGCATGGTGG - Intergenic
1171099419 20:22368585-22368607 CATGAGACCTAGAGGGAAGGAGG - Intergenic
1171344105 20:24452690-24452712 AAGGAGGGCTGGAGGGAAAGGGG - Intergenic
1171438179 20:25140084-25140106 CATCAGGGCAGACGGGCAGGAGG - Intergenic
1172020987 20:31913848-31913870 CGTCAGGGTTGGTGGGGAGGTGG + Intronic
1172300016 20:33842824-33842846 ATTCAGGCATGGAGGGAAGGAGG - Intronic
1173329257 20:42060652-42060674 AATCATGGCTGAAGGCAAGGAGG - Intergenic
1173657407 20:44709890-44709912 CAGCAGGGCTGGAAGTGAGGAGG - Intergenic
1173703587 20:45094183-45094205 GATGAGTCCTGGAGGGAAGGAGG - Exonic
1173832803 20:46102834-46102856 CAAGAGGGCGGGAAGGAAGGAGG + Intergenic
1174056377 20:47800947-47800969 CATCTGGGCAGCAGGGAGGGGGG + Intergenic
1174185602 20:48703821-48703843 CAGCAGGGCTGGGGTGGAGGGGG - Intronic
1174301881 20:49588341-49588363 CATCCGGGCTGGAGAGATGCTGG + Intergenic
1175123656 20:56735882-56735904 CAGCAGGGATGAAGGGATGGTGG - Intergenic
1175164455 20:57033403-57033425 CAGTGGGGCTGGAGAGAAGGGGG + Intergenic
1175183382 20:57164118-57164140 AATCATGGCAGGAGGCAAGGAGG - Intergenic
1175258885 20:57662805-57662827 CATCAGCCCTGGAGGGAGGGAGG + Intronic
1175379270 20:58551659-58551681 GCTCAGGGCTAGAGGGAATGGGG - Intergenic
1175390594 20:58624920-58624942 CGGCAGGGCTGGAGAGCAGGGGG + Intergenic
1175665666 20:60857647-60857669 AATCAGGGCAGAAGGGAGGGGGG + Intergenic
1175984115 20:62755600-62755622 AATGAGGGATGGAGGGAGGGAGG - Intronic
1175984170 20:62755756-62755778 GATGATGGCTGGAGGGAGGGAGG - Intronic
1175984213 20:62755876-62755898 AATGAGGGATGGAGGGAGGGAGG - Intronic
1176358380 21:5971815-5971837 AATCATGGCAGGAGGTAAGGAGG - Intergenic
1176456415 21:6916251-6916273 CATCAGTCCTGTAGGGATGGGGG - Intergenic
1176834590 21:13781311-13781333 CATCAGTCCTGTAGGGATGGGGG - Intergenic
1177258096 21:18692209-18692231 AATCATGGCAGAAGGGAAGGAGG + Intergenic
1177266877 21:18797525-18797547 AATCATGGCAGAAGGGAAGGAGG - Intergenic
1178379053 21:32093124-32093146 CATCATGGCGGGAGGCAAGGAGG + Intergenic
1178432760 21:32531036-32531058 AATCATGGCGGGAGGCAAGGAGG - Intergenic
1178744775 21:35238261-35238283 CAGCAGGGGTGGAGGGGAGCTGG + Intronic
1178837571 21:36111720-36111742 ATTCAGGGAGGGAGGGAAGGAGG + Intergenic
1179124577 21:38579556-38579578 CATGAGGACTGGAGGAAAGAGGG + Intronic
1179272660 21:39863579-39863601 GCTCAGGGCAGCAGGGAAGGAGG + Intergenic
1179403757 21:41108668-41108690 CCTCATGGCTGGAGGGAAGCTGG + Intergenic
1179765138 21:43566735-43566757 AATCATGGCAGGAGGTAAGGAGG + Intronic
1179776320 21:43665765-43665787 CATCTTGGCTGGAGGGGAAGGGG - Intronic
1179809590 21:43861998-43862020 CATCCAGGCTGGAGTGCAGGGGG + Intergenic
1180133533 21:45844445-45844467 CAACAATGCTGGAGGGAGGGTGG - Intronic
1180151561 21:45950801-45950823 CAACAGGGCTGGAGGGAGGGAGG - Intergenic
1181136897 22:20773697-20773719 CATCAGTCCTGGAGAGCAGGTGG + Intronic
1181545442 22:23599695-23599717 AACCAGGGCTGGAGGGCAGAGGG - Intergenic
1181597369 22:23925103-23925125 GATTAGAGCTGGTGGGAAGGGGG - Intergenic
1181814868 22:25430204-25430226 AACCAGGGCTGGAGGGCAGAGGG + Intergenic
1182049984 22:27305276-27305298 AGTCAGGGCTGGGGGGAAGTTGG - Intergenic
1182098567 22:27642161-27642183 CAGCAGGGGTCGAGGGCAGGGGG + Intergenic
1182813600 22:33138482-33138504 CATCCAGGCTGGAGGGCAGTGGG + Intergenic
1182914354 22:34015465-34015487 CACCCAGGCTGGAGTGAAGGTGG + Intergenic
1182985585 22:34713217-34713239 CATCTAGCCTGGAAGGAAGGTGG + Intergenic
1182989182 22:34750714-34750736 CAGCAGGGTTGGAGGAAAGTGGG + Intergenic
1183108334 22:35630291-35630313 GAACAGGGGAGGAGGGAAGGAGG + Intronic
1183247351 22:36703828-36703850 CACCAAGGGGGGAGGGAAGGGGG - Intergenic
1183545402 22:38452720-38452742 CCTCGGGGCTGTAGGGCAGGGGG - Intronic
1183710341 22:39499738-39499760 GATCATGGCTGGAGGGAGAGAGG - Intronic
1183943189 22:41308214-41308236 TGTGAGGGCTGCAGGGAAGGTGG + Intronic
1184301160 22:43561933-43561955 GAGCAGGGCTGCAGGAAAGGCGG + Intronic
1184443818 22:44535589-44535611 CATCGGGCCTGGAGAGGAGGCGG + Intergenic
1184490742 22:44807347-44807369 CAGCAGGGCAGGATGGAACGTGG + Intronic
1184537542 22:45097586-45097608 AATCAGGGCGGAAGGCAAGGAGG - Intergenic
1184678198 22:46054568-46054590 CAGCAGGGGTGGAGGGTGGGAGG + Intronic
1184689289 22:46110186-46110208 CATCGGAGCTGGAGTGCAGGTGG - Intronic
1184779584 22:46640352-46640374 CATGTGGGGTGGAGGGATGGAGG + Intronic
1185042778 22:48513921-48513943 CAGCAGGGCAGGAGGAAAGGGGG + Intronic
1185150125 22:49159495-49159517 CATCAGGGCGGGATGGAACTGGG + Intergenic
1185338397 22:50280966-50280988 CATCAGGTCTGGGGGGAGGCTGG + Exonic
949248903 3:1959092-1959114 CATCAAGGTTGGAGGTAATGAGG - Intergenic
949717804 3:6953506-6953528 CATCAGAGTTGGAGGCATGGGGG - Intronic
949740229 3:7224219-7224241 AATCATGGCGGAAGGGAAGGGGG + Intronic
949867143 3:8555407-8555429 CATCTGAGCTGGAGGACAGGAGG + Intronic
950004016 3:9679849-9679871 CAGCAGGGCTGGAGTGTAGCAGG + Intronic
950052955 3:10005922-10005944 CATCAGTGAGAGAGGGAAGGTGG - Intronic
950079779 3:10213110-10213132 CACCAGAGATGGAGGGATGGAGG - Intronic
950201945 3:11050720-11050742 CATCAGGGCATGAGGGAAGCAGG - Intergenic
950534014 3:13569151-13569173 CATGAGGACTGGTGAGAAGGTGG + Intronic
950844630 3:16002691-16002713 CATCATGGGTGAATGGAAGGTGG - Intergenic
951202430 3:19890269-19890291 GATCAGGGCTTGGGGGAGGGAGG - Intronic
951498952 3:23362488-23362510 CAGCAGGGATGGAGGGAGGAGGG - Intronic
952003254 3:28810294-28810316 GAGCAGGGCTGGAGGGAACTGGG + Intergenic
952038571 3:29234134-29234156 CATCAGGACTTGGGGGAAGTAGG + Intergenic
952401366 3:32966890-32966912 AATCATGGCAGGAGGCAAGGAGG - Intergenic
953782037 3:45879972-45879994 CATCAGGGGTGGCAGGAGGGAGG + Intronic
954613518 3:51958265-51958287 CGTCAGGGGTGGCGAGAAGGGGG + Exonic
954663331 3:52237601-52237623 CACCAGGGCTGGAGGCTGGGAGG + Intronic
954709405 3:52497871-52497893 CAACAGGACTGGAGTGAAGATGG + Intronic
954793467 3:53149327-53149349 CCTGAGGGGAGGAGGGAAGGGGG - Intergenic
955502880 3:59602414-59602436 TATCGGGGCTGGAGGGTGGGAGG - Intergenic
955503289 3:59606276-59606298 AATCAGGTCTGGAGGGTAGCCGG + Intergenic
955820443 3:62890783-62890805 AATCATGGCTGAAGGCAAGGAGG + Intergenic
956248930 3:67215264-67215286 CCTCTGGACTGTAGGGAAGGCGG - Intergenic
956771057 3:72526268-72526290 CATGAGGGAGGGAGGGAGGGAGG + Intergenic
956917681 3:73890164-73890186 CATCAGGGTTTGAGAGGAGGTGG + Intergenic
957719609 3:83977292-83977314 AATCATGGCGGGAGGCAAGGAGG + Intergenic
958489796 3:94757791-94757813 CAGCAGGCCTGGAGAGAAGGTGG + Intergenic
958917201 3:100062810-100062832 AATCCAGGCTGGAGGGGAGGAGG - Intronic
958941894 3:100326076-100326098 GGTAAGGGCTGGAGGGAAGAGGG - Intergenic
959174062 3:102882812-102882834 AATCATGGCTGAAGGCAAGGAGG - Intergenic
959661757 3:108876343-108876365 TATTAGGGCCAGAGGGAAGGGGG + Intergenic
960529109 3:118743333-118743355 AGTCAGGGCTGGTGGAAAGGAGG - Intergenic
961749889 3:129088660-129088682 CTTCTGGGGTGGAGGGACGGGGG + Exonic
961811910 3:129526914-129526936 CAGGTGGGCTGCAGGGAAGGGGG + Intergenic
962369040 3:134805527-134805549 CAGGAGGGCAGGAGGCAAGGTGG - Intronic
962693080 3:137920481-137920503 CATCTAGGATGGGGGGAAGGAGG + Intergenic
964090310 3:152868540-152868562 CAGAAGGGCTGGAGGGATGTGGG - Intergenic
964108088 3:153060401-153060423 TATCAGGAAGGGAGGGAAGGAGG + Intergenic
964187907 3:153968343-153968365 CATCATGGCAGAAGGCAAGGAGG + Intergenic
964719224 3:159755301-159755323 AATCATGGCAGCAGGGAAGGAGG + Intronic
965083884 3:164069455-164069477 AAAGAGGGCAGGAGGGAAGGAGG + Intergenic
965083887 3:164069463-164069485 CAGGAGGGAAGGAGGGAAGGTGG + Intergenic
966038381 3:175448747-175448769 CATCAGGGCTAGAGTGCAAGTGG + Intronic
966299856 3:178465960-178465982 CATGAGGGCTGCAGGTGAGGAGG - Intronic
966747974 3:183296416-183296438 CTTCAGGGCTGGAGGGAGCCTGG - Intronic
966912391 3:184566708-184566730 CAGCGGGGCAGGAGGGCAGGGGG - Intronic
967104197 3:186242262-186242284 GGGCAGGGCTGGAGGGCAGGAGG - Intronic
967449755 3:189610856-189610878 CATCATGGCAGAAGGCAAGGAGG + Intergenic
967462413 3:189761825-189761847 AATCATGGCTGAAGGCAAGGAGG + Intronic
967516276 3:190372601-190372623 CACCAAGGCTGGAGGGTAGTAGG - Intronic
967814258 3:193786035-193786057 CATCAGGCTTGGAAGGGAGGCGG - Intergenic
967829444 3:193906185-193906207 CGTCAGTGGTGGAGGGAAGCAGG + Intergenic
967877638 3:194277695-194277717 AATCAGGGCCAGAGGGATGGTGG - Intergenic
968288681 3:197522809-197522831 CCTCAGGGTGGGAAGGAAGGAGG - Intronic
968449233 4:667324-667346 CGTCAGTGCTGGGGAGAAGGTGG + Intronic
968669832 4:1843319-1843341 AATCAGGGCTGGAAGCCAGGCGG + Intronic
968844242 4:3031092-3031114 AAGATGGGCTGGAGGGAAGGGGG + Intronic
968890517 4:3366277-3366299 GGTCAGGGGTGGAGGGCAGGAGG + Intronic
969211356 4:5689939-5689961 CAGCAGAGCTGGAGAGAAGCTGG - Intronic
969227889 4:5811091-5811113 CAGCACTGCAGGAGGGAAGGTGG - Exonic
969624534 4:8295567-8295589 CACTAGGGCTGAAGAGAAGGTGG - Intronic
969659539 4:8518414-8518436 CATTAGGGCAGAAGGGAGGGCGG + Intergenic
969664478 4:8549242-8549264 CATCAGGGCTGGACAGGAGAAGG + Intergenic
970137746 4:12944412-12944434 CAGCAGGGCAGAAAGGAAGGAGG - Intergenic
970294498 4:14614047-14614069 CTACACGGCTGGATGGAAGGGGG + Intergenic
970767179 4:19563757-19563779 CACCAGGGCTGGAGACAAGAAGG - Intergenic
971071830 4:23103632-23103654 AATCATGGCAGGAGGCAAGGAGG - Intergenic
971538155 4:27780535-27780557 AATCAGGGCAGAAGGCAAGGAGG - Intergenic
972430885 4:38980770-38980792 CATCAGGGTGGGAGGGGAGCAGG + Intronic
974797244 4:66767823-66767845 AATCATGGCAGGAGGCAAGGAGG - Intergenic
975063520 4:70035027-70035049 CACCAGGGATGGGGGGTAGGAGG + Intronic
975089240 4:70381418-70381440 AAGGAGGGCAGGAGGGAAGGAGG + Intronic
975296139 4:72736580-72736602 CCTGATGGGTGGAGGGAAGGCGG + Intergenic
976461428 4:85316746-85316768 GACCAGAGCTGGAGGCAAGGTGG + Intergenic
977021641 4:91767634-91767656 TGTCAGGGCTGGAGGGAGGTGGG - Intergenic
977655211 4:99513641-99513663 AATGAGGGCAGGAGGCAAGGAGG - Intronic
978588833 4:110302286-110302308 TCTTAGGGCTGGAGGCAAGGAGG - Intergenic
979679491 4:123444223-123444245 AATCAGGGAGAGAGGGAAGGAGG - Intergenic
980896461 4:138865356-138865378 GATCAGGGCTGTCTGGAAGGAGG - Intergenic
981489818 4:145327589-145327611 AGTCAAGGCTGGAGGCAAGGAGG + Intergenic
981517190 4:145622306-145622328 AATCATGGCTGAAGGCAAGGAGG - Intronic
982670417 4:158313945-158313967 CAGAAGGGCTGGTGGGCAGGTGG + Intergenic
982720130 4:158850626-158850648 AGTGGGGGCTGGAGGGAAGGAGG + Intronic
983669223 4:170216230-170216252 AATCATGGCAGGAGGCAAGGAGG - Intergenic
983832267 4:172341730-172341752 AATCATGGAGGGAGGGAAGGAGG - Intronic
984251730 4:177344151-177344173 AATCAGGTCGGGAGGGAAGAGGG - Intronic
984373343 4:178894652-178894674 CAGCACCGGTGGAGGGAAGGAGG + Intergenic
984892590 4:184506952-184506974 CATCAGCGCTGGAGTGTTGGAGG + Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985657961 5:1141991-1142013 CTGCAGGGCTGCAGGGAAGAGGG - Intergenic
985663624 5:1169855-1169877 CAGCAGGGAAGGAGGGGAGGAGG + Intergenic
985771647 5:1815502-1815524 CTTCAGGGCTGGAGCCCAGGAGG - Intronic
985966139 5:3340037-3340059 CATCCGGCCTGGAGGAGAGGCGG - Intergenic
986306048 5:6517810-6517832 AATCATGGCAGAAGGGAAGGAGG + Intergenic
986347191 5:6846253-6846275 CTTCGGGGGTGGAGGGGAGGGGG - Intergenic
987360991 5:17106287-17106309 AATGAGGGCTGGATGGATGGAGG + Intronic
988668749 5:33359055-33359077 AATCATGGCAGGAGGCAAGGAGG + Intergenic
989043161 5:37249461-37249483 GAGCAGGGCTGGAGGGGCGGAGG - Intergenic
989581684 5:43039577-43039599 CGCCACGGCTGGAGGGCAGGAGG + Exonic
989731470 5:44654925-44654947 AATCAGGGCAGAAGGCAAGGAGG + Intergenic
990324884 5:54665427-54665449 CATCAGGGTTCGGGGGTAGGAGG - Intergenic
990816752 5:59794477-59794499 CAGGAGGGAGGGAGGGAAGGAGG - Intronic
991446156 5:66702365-66702387 CATTAGGGGTAGAGGGAATGTGG + Intronic
991851250 5:70924488-70924510 CATGGGGGCAGGAAGGAAGGCGG - Intergenic
992706146 5:79395270-79395292 AATCAGGGCTGGAAGAAAGGGGG - Intronic
995207446 5:109497433-109497455 CAAGAGGGATGGAGGGAAGAAGG + Intergenic
995449218 5:112281642-112281664 CATGAGTGCTGGATGGAACGTGG - Intronic
995468031 5:112470904-112470926 CATCACTGCTGGAGGGAGGCAGG + Intergenic
995582179 5:113613681-113613703 CATCATGGCAGAAGGCAAGGAGG - Intergenic
996177752 5:120379857-120379879 AATCATGGCAGGAGGCAAGGGGG - Intergenic
996592946 5:125168592-125168614 CATCAGGGTGGGAGGCCAGGAGG - Intergenic
997470779 5:134115611-134115633 CACCTGGGCAGGAGGGGAGGCGG - Intronic
998344014 5:141444915-141444937 TATCAGGGAAAGAGGGAAGGAGG + Intronic
998372986 5:141672970-141672992 AGTCAGGGCAGGAGGGAGGGAGG - Intronic
999231178 5:150062938-150062960 CATCATGGCTTGAGGGAAGTGGG + Intronic
999251944 5:150188017-150188039 CACCAGGGCTGTGGGGATGGAGG + Intergenic
1000335307 5:160237627-160237649 CATATGGGATGGATGGAAGGTGG - Intronic
1001854161 5:174996230-174996252 CATCAGGGTTGAAGGGAGGTTGG + Intergenic
1001917779 5:175575934-175575956 TTTCAGGGGTGCAGGGAAGGAGG + Intergenic
1001919496 5:175588958-175588980 CAGCAAGGAAGGAGGGAAGGAGG + Intergenic
1001949919 5:175809117-175809139 CATCAGGGCTCCAGGGATGAGGG - Intronic
1001998136 5:176178554-176178576 CATCAGGGTGGGAGGTATGGAGG - Intergenic
1002393530 5:178935598-178935620 ATTCAAGGCAGGAGGGAAGGGGG + Intergenic
1002401811 5:178995177-178995199 CGGCAGGGCTGGAGGGGTGGAGG - Intronic
1002419495 5:179138230-179138252 CATCAGTGCTGGGGAGGAGGTGG - Intronic
1002454574 5:179338847-179338869 CACCAGGCGTGGAGGGAAGCCGG + Intronic
1002461431 5:179375845-179375867 CAGCAGGGGAGGGGGGAAGGGGG + Intergenic
1002782991 6:381014-381036 CAGGAGGGGTGGAGGGAAAGAGG + Intergenic
1002940100 6:1708356-1708378 GATGAGGAGTGGAGGGAAGGCGG + Intronic
1003148911 6:3532187-3532209 CACCAGGGCCTGGGGGAAGGAGG - Intergenic
1003335828 6:5171351-5171373 CATAGGAGCTGGAGGGATGGAGG - Intronic
1003723606 6:8733834-8733856 GATCAGGGATGGGGGAAAGGAGG - Intergenic
1004031252 6:11871584-11871606 AATCATGGCGGGAGGCAAGGAGG + Intergenic
1005264882 6:24101233-24101255 CAACAGGGCTGGAGGAAAATGGG + Intergenic
1005871036 6:29974689-29974711 CATCTGCACTGGAGGGGAGGGGG + Intergenic
1006058885 6:31404765-31404787 CATCTGCACTGGAGGGGAGGGGG - Intronic
1006327393 6:33364920-33364942 CTCCAGGCCTGCAGGGAAGGAGG + Intergenic
1006420561 6:33931281-33931303 CTTGAGGGCTGGAGGGTAGCGGG + Intergenic
1006750649 6:36374628-36374650 CATCAGGGCTGTGGGGAAGCTGG + Intronic
1006785938 6:36667339-36667361 TTTCAGGGCTGCAGGGAAGTGGG + Intergenic
1006807905 6:36800379-36800401 CATCAGGCCTTGAAGGAATGAGG - Intronic
1006939792 6:37744113-37744135 CATCAGGGCTGGTGGGAGGATGG + Intergenic
1007251626 6:40499248-40499270 CATCAGGGCTGGGGAGATGGGGG - Intronic
1007337976 6:41168469-41168491 CATCCGGGATGGAGGGAGGCAGG - Intergenic
1007340155 6:41186169-41186191 CAGGAGGCCTGGAAGGAAGGGGG + Intergenic
1007762476 6:44141116-44141138 CAGCAGGGCTTGAGGGTAGGGGG - Intronic
1007785808 6:44278544-44278566 CCTCAGGGCTCCAAGGAAGGAGG + Exonic
1007801919 6:44401580-44401602 CCTCTGAGCTGGGGGGAAGGAGG + Intronic
1007842842 6:44730799-44730821 CAGGGGGGCTGGAGGGAAGTAGG - Intergenic
1008408693 6:51147923-51147945 CATCAGTGCTGCAGAGAAGCGGG + Intergenic
1008585653 6:52946335-52946357 CATCTGGGCTGGTGGCACGGGGG + Intergenic
1008906807 6:56686673-56686695 GATCACAGCGGGAGGGAAGGTGG + Intronic
1009438792 6:63651400-63651422 CATCCAGGCTGGAGTGCAGGGGG + Intronic
1009494181 6:64328418-64328440 AATAAAGGCTGGAGGGAAGAAGG + Intronic
1009566204 6:65313991-65314013 CAGCAAGGCTGGAGGGGAGTGGG - Intronic
1010450258 6:75994538-75994560 CATCATGGCAGAAGGCAAGGAGG + Intronic
1010659565 6:78554458-78554480 CAAAATGGCTGGAGGGATGGGGG + Intergenic
1010771758 6:79839973-79839995 CATCTGGGCAGGAGAGAGGGAGG + Intergenic
1012359404 6:98358662-98358684 CAGCAAGGATGGTGGGAAGGAGG + Intergenic
1012442011 6:99269699-99269721 CTTCAGGGGAGGATGGAAGGAGG + Intergenic
1012589903 6:100968652-100968674 GATCAGGGCTGAATTGAAGGAGG + Intergenic
1013314556 6:108929132-108929154 GATCAGATCTGGAGGGAAGGAGG - Intronic
1014257959 6:119183131-119183153 CATCAGGGCTGGAGGACAGAAGG + Intronic
1015590306 6:134816644-134816666 GATCTGGGCTGGAGGGTGGGTGG + Intergenic
1015856580 6:137631454-137631476 CCTTAGGGCTGGAAGGAAGCTGG + Intergenic
1016181503 6:141153264-141153286 AGACAGGGCTGCAGGGAAGGGGG + Intergenic
1016426477 6:143941483-143941505 CATGAGGGATGGGGGGCAGGGGG + Exonic
1016477459 6:144442557-144442579 AATCATGGCAGAAGGGAAGGAGG + Intronic
1017033985 6:150250841-150250863 GATCAGGGCAGGAGGGAAGGTGG - Intergenic
1017510775 6:155112804-155112826 CAGCAGGACTCGAGGGCAGGTGG - Intronic
1017609358 6:156168055-156168077 CACCCAGGCTGGAGGGAGGGAGG + Intergenic
1018065830 6:160124679-160124701 TGTCAGGGCTGGGGAGAAGGAGG + Intronic
1018764991 6:166925900-166925922 CAACAGGGCAGGAGGGATTGAGG + Intronic
1018811216 6:167299793-167299815 CCGCAGGGCTGGGGGCAAGGTGG + Intronic
1018967529 6:168500244-168500266 CATCCGGGCTGGAGTGCAGTGGG - Intronic
1019103266 6:169649407-169649429 CTTAAGGGCTGGAGGACAGGTGG - Intronic
1019279435 7:192671-192693 GACCGGGGCTGGGGGGAAGGGGG - Intergenic
1019357138 7:586495-586517 CAACAGGGCTGGAGGGTGGCAGG - Intronic
1019406148 7:885300-885322 CAGCAGGCGTGGAGGGCAGGAGG - Intronic
1019543291 7:1560931-1560953 AATCCGGGCAGGGGGGAAGGTGG - Intergenic
1019686824 7:2386583-2386605 CATCAGGAAGGGAGGGAGGGAGG + Intergenic
1019702572 7:2481024-2481046 CATCGGGGCTGTGGGGCAGGTGG - Intergenic
1019935038 7:4249308-4249330 GAGCAGGACTGGTGGGAAGGTGG - Intronic
1020088328 7:5323441-5323463 CATGGGGGCAGCAGGGAAGGAGG - Intronic
1020095862 7:5368955-5368977 CCTCTGGGGTGTAGGGAAGGGGG - Intronic
1020095977 7:5369566-5369588 CAAGAGGGAAGGAGGGAAGGAGG + Intronic
1020847643 7:13307177-13307199 TATCATGGCAGAAGGGAAGGAGG - Intergenic
1021094474 7:16519979-16520001 CTTCAGGGATGGAGAGTAGGAGG - Intronic
1021948518 7:25752223-25752245 CTGCAGGGCTGGGGGGAAGTAGG + Intergenic
1022481972 7:30750183-30750205 AATCATGGCTGAAGGCAAGGAGG + Intronic
1022538664 7:31114900-31114922 CATCAGGGGCAGAGGGGAGGAGG - Intergenic
1023056926 7:36298268-36298290 CAACAGGGCTGGAAGGAAGTTGG + Intronic
1023518669 7:41029082-41029104 CATCAGGGGAGGAGGGCATGAGG - Intergenic
1023840909 7:44097020-44097042 CCCCAGGGCTGGAGGGAGGAGGG + Intergenic
1024007187 7:45233625-45233647 CATCAGGAATTGAGGGAGGGAGG - Intergenic
1024036025 7:45508310-45508332 CATCATTGCTGGTGGGAATGTGG - Intergenic
1024242228 7:47444559-47444581 CCTGACGGCAGGAGGGAAGGAGG + Intronic
1024261275 7:47576010-47576032 GGACAGGGCTGGAGGAAAGGGGG - Intronic
1024283219 7:47736339-47736361 AAGCAGGGAGGGAGGGAAGGAGG - Intronic
1024328193 7:48130032-48130054 AATCACGGCTGAAGGCAAGGAGG + Intergenic
1025085593 7:56020693-56020715 CTGCAGGGCGGGAGGGCAGGAGG + Intronic
1026079554 7:67205535-67205557 CATTACAGCTGGAGGGGAGGAGG + Intronic
1026601727 7:71783104-71783126 AATCAGGTGTGGAGGGAAGATGG + Exonic
1026697295 7:72606447-72606469 CATTACAGCTGGAGGGGAGGAGG - Intronic
1026818375 7:73529913-73529935 CATCCAGGCTAGAGGGCAGGGGG - Intergenic
1027199339 7:76053233-76053255 GACCAGGGATGGAGGGAGGGGGG + Intronic
1027569689 7:79848390-79848412 CATCAGGACTGGGGGGCAGTAGG - Intergenic
1028064194 7:86361063-86361085 CATCAGGGAAGGAGGGAACAAGG + Intergenic
1028255558 7:88592068-88592090 CTTCAGGGCTGGAAGTATGGAGG - Intergenic
1028270927 7:88788180-88788202 CATGAGGACTGGAGGCCAGGTGG + Intronic
1028932036 7:96423988-96424010 AAGCAGGGCTGGAGGAAAGGAGG - Intergenic
1029392950 7:100287696-100287718 GGCCAGAGCTGGAGGGAAGGGGG - Intergenic
1029425069 7:100489696-100489718 CATCAGGGGTGGGGGGCAGCTGG + Intronic
1029495560 7:100894227-100894249 CCTCATGGCTGCAGGGCAGGCGG + Exonic
1029574664 7:101395558-101395580 CAGCGGGGCTGGAGGGAAAATGG + Intronic
1029723697 7:102387959-102387981 CATCCAGGCTGGAGGGCAGTGGG - Intronic
1030035516 7:105405306-105405328 AATCAGGGCAGGGGAGAAGGAGG + Intergenic
1031268385 7:119611836-119611858 TGACAGGGCTCGAGGGAAGGTGG - Intergenic
1031593544 7:123621950-123621972 CATCAGGAATGGAGGGCAGTGGG - Intronic
1033024692 7:137760849-137760871 CCTCTGGACTGGAAGGAAGGAGG - Intronic
1033264679 7:139874617-139874639 CATAAGGGGTGGAATGAAGGTGG - Intronic
1033403123 7:141046293-141046315 AATCATGGCTGAAGGCAAGGAGG + Intergenic
1033443140 7:141397948-141397970 CATCAGGGCAGCAGGGAAAATGG + Intronic
1033660667 7:143399729-143399751 CATCAGGGCTGCAGTGCATGCGG + Exonic
1034564168 7:151900061-151900083 CTTCTGGAGTGGAGGGAAGGAGG - Intergenic
1034590169 7:152131846-152131868 TAGCAGGGCTGGAGTGAGGGAGG + Intergenic
1034738278 7:153449272-153449294 GACAAGGGCTGGAGGGAAGCAGG + Intergenic
1034938677 7:155216050-155216072 CCTCATGTCTGGTGGGAAGGAGG - Intergenic
1034960775 7:155362990-155363012 AACCAGGCCTGCAGGGAAGGCGG + Intronic
1035021640 7:155804148-155804170 CGCCGGGGCGGGAGGGAAGGAGG - Intronic
1035271409 7:157722196-157722218 CTTCACGGCTGGTGGGAAGACGG + Intronic
1035546717 8:487249-487271 CATCTGGGCTTAAGGGAGGGCGG + Intergenic
1035645273 8:1214135-1214157 AATGAGGTGTGGAGGGAAGGGGG - Intergenic
1035689886 8:1553189-1553211 CCTGAGGACAGGAGGGAAGGAGG - Intronic
1036778269 8:11628456-11628478 CAGTAGGGATGCAGGGAAGGGGG + Intergenic
1037936683 8:22919748-22919770 CTTCTGGGCTGGAGAGAAGCTGG - Intronic
1037993743 8:23338575-23338597 CTGCATGGCGGGAGGGAAGGGGG + Intronic
1038012459 8:23486034-23486056 AGTCAGGGAGGGAGGGAAGGAGG - Intergenic
1038347840 8:26748344-26748366 CAGCAGGGCTGGACGGATGTTGG - Exonic
1038349449 8:26762892-26762914 CATCAGGACTGGAGAGAGGAAGG + Intronic
1038410200 8:27352460-27352482 CTTCAGGGGTGGAGGGGGGGCGG + Intronic
1039181633 8:34873372-34873394 AATCATGGCTGAAGGCAAGGAGG + Intergenic
1039475342 8:37836653-37836675 CATGAGGGATGGACTGAAGGTGG - Intronic
1039953689 8:42191320-42191342 CATCAGGGAGGGAGGCAGGGCGG - Intronic
1039975810 8:42363965-42363987 CACCCGGGCTGGAGTGCAGGAGG + Intronic
1040007515 8:42632773-42632795 CAGCTGGGCTGGAGGGAGTGAGG - Intergenic
1041618658 8:59938282-59938304 AATCATGGCAGGAGGCAAGGAGG - Intergenic
1042230024 8:66545711-66545733 GAGGAGGGATGGAGGGAAGGAGG + Intergenic
1042591476 8:70402702-70402724 CTTCAGGGGCGGAGAGAAGGGGG + Intronic
1042836953 8:73087659-73087681 CATCATATCTGGAGGGAAAGAGG - Intronic
1043275660 8:78389171-78389193 CATCATGGCAGAAGGCAAGGAGG + Intergenic
1044043307 8:87397953-87397975 AATCATGGCAGAAGGGAAGGAGG - Intronic
1044220901 8:89668807-89668829 CCTCAGGACTGTAGGGAAGCGGG - Intergenic
1045471339 8:102514892-102514914 CATCAGGGCTGGAAAAAAGGAGG + Intergenic
1045972580 8:108096008-108096030 GATCAGGGAGGGAGGGAAGGAGG + Intergenic
1046251751 8:111642077-111642099 AATCAGGGCAGAAGGCAAGGAGG + Intergenic
1047115452 8:121836985-121837007 CATCATGGCAGAAGGCAAGGAGG - Intergenic
1047149294 8:122242263-122242285 AATCATGGCAGAAGGGAAGGAGG - Intergenic
1047169913 8:122482759-122482781 CATCATGGCTTGAAGTAAGGTGG - Intergenic
1047432622 8:124805849-124805871 CATCTGGGCTGGTGAGAAGCTGG - Intergenic
1047670014 8:127135945-127135967 GAAGAGGGCTGGAGGGAGGGTGG - Intergenic
1048430357 8:134364776-134364798 AATCATGGCAGGAGGCAAGGAGG + Intergenic
1048432538 8:134383652-134383674 CACCAGGGTAGGAGGGGAGGTGG - Intergenic
1048511902 8:135070482-135070504 CATGAGGGGTAGAGTGAAGGGGG + Intergenic
1049054752 8:140227127-140227149 GAACAGAGCTGGAGAGAAGGGGG + Intronic
1049271364 8:141697981-141698003 CATCAGGGGAAGAGGCAAGGAGG - Intergenic
1049318282 8:141981286-141981308 TATCAGGGCTGGAGGAAGGAGGG + Intergenic
1049341503 8:142115004-142115026 CAACAGGGTGGGAGGGATGGGGG - Intergenic
1049433523 8:142576006-142576028 CACCCAGGCTGGAGGGAAGCAGG + Intergenic
1049469661 8:142769676-142769698 GCCCAGGGCTGGAGGGACGGTGG + Intronic
1049508928 8:143018268-143018290 CAGCAGGGCCGGGTGGAAGGAGG + Intronic
1049594599 8:143477580-143477602 CACCAGGCCTGGAGGGAGGCAGG + Intronic
1049749248 8:144275682-144275704 CACCAGGGGTGGGGGGCAGGGGG + Intronic
1049883996 9:15839-15861 ACTCAGGGCTGGAGGGGAGGAGG + Intergenic
1050053824 9:1631330-1631352 CCTCAGAGGTGGAGGGAAGGAGG + Intergenic
1050176170 9:2871479-2871501 TATGAGGGCTGGAGGGAAACTGG + Intergenic
1052335475 9:27315083-27315105 CAGAGGGGCTGGAGGGAAAGGGG + Intergenic
1052503001 9:29316909-29316931 CTTAAGGGAGGGAGGGAAGGGGG + Intergenic
1052852406 9:33386028-33386050 CCTGAGGGGTGGAGGGCAGGGGG + Intronic
1053442552 9:38128121-38128143 CATCAGAGCTGGAGGGTACCAGG + Intergenic
1053620110 9:39806458-39806480 TGTCAGGGGTTGAGGGAAGGAGG + Intergenic
1053626587 9:39877484-39877506 TGTCAGGGGTTGAGGGAAGGAGG - Intergenic
1053680505 9:40482579-40482601 CCTGAGGGGTGGAGGGCAGGGGG + Intergenic
1053878282 9:42565760-42565782 TGTCAGGGGTTGAGGGAAGGAGG + Intergenic
1053894379 9:42728607-42728629 TGTCAGGGGTTGAGGGAAGGAGG - Intergenic
1053930494 9:43110890-43110912 CCTGAGGGGTGGAGGGCAGGGGG + Intergenic
1054217300 9:62373219-62373241 TGTCAGGGGTTGAGGGAAGGAGG + Intergenic
1054233411 9:62535934-62535956 TGTCAGGGGTTGAGGGAAGGAGG - Intergenic
1054264046 9:62900986-62901008 TGTCAGGGGTTGAGGGAAGGAGG - Intergenic
1054283207 9:63142356-63142378 CCTGAGGGGTGGAGGGCAGGGGG - Intergenic
1054293590 9:63318094-63318116 CCTGAGGGGTGGAGGGCAGGGGG + Intergenic
1054391612 9:64622583-64622605 CCTGAGGGGTGGAGGGCAGGGGG + Intergenic
1054504116 9:65893745-65893767 CCTGAGGGGTGGAGGGCAGGGGG - Intronic
1054931598 9:70641054-70641076 CATCATGTCTGGAAGGATGGGGG - Intronic
1055630876 9:78221980-78222002 CATCATGGCAGAAGGCAAGGAGG + Intergenic
1055634700 9:78264994-78265016 CTTGAGGACTGGAGGAAAGGTGG + Intronic
1056466760 9:86864386-86864408 CATCAGGGAGGGAGGAAAGAAGG + Intergenic
1057076865 9:92142433-92142455 CCTCAGAGCTGGAGGGCTGGGGG + Intergenic
1057406164 9:94772679-94772701 CACCAGGGCCTGAGGGGAGGGGG + Intronic
1057421884 9:94919430-94919452 TCTCAGGGCCAGAGGGAAGGAGG + Intronic
1057519744 9:95751657-95751679 CATGAGGGAGGGAGGGAGGGAGG + Intergenic
1057719077 9:97517907-97517929 CATCCAGGCTTGAGGGAGGGGGG + Intronic
1057999380 9:99849519-99849541 CATCAGGACTGGAAGGAAACTGG + Intronic
1059300670 9:113310397-113310419 CATAAAGGCTGAGGGGAAGGGGG - Intergenic
1059311342 9:113390767-113390789 CAGCAGGGCTGGTGGGAGGGAGG + Intronic
1059366959 9:113793816-113793838 GATGAGGGCAGGAAGGAAGGGGG + Intergenic
1059857206 9:118413101-118413123 CATCACTGATGGAGGGAGGGAGG - Intergenic
1059949212 9:119444474-119444496 AACCAGGGCTGGAGGGATGAGGG + Intergenic
1060329970 9:122659123-122659145 CCTAGTGGCTGGAGGGAAGGAGG + Intergenic
1060447992 9:123709516-123709538 GATCAGGGGTGGAGGGTAAGAGG - Intronic
1060505169 9:124192167-124192189 CATCAGGGAAGTAGGGAAGTGGG + Intergenic
1060527515 9:124328800-124328822 CAGCGGGGCTGGCGGGGAGGGGG + Intronic
1060727180 9:126014436-126014458 CATCATGGCTGGAAAGAGGGAGG - Intergenic
1060819714 9:126654312-126654334 AATCAGGGCTGGAGTGGGGGAGG - Intronic
1060927802 9:127467439-127467461 CTTAAGGGAGGGAGGGAAGGGGG + Intronic
1061043660 9:128153211-128153233 CAGCAGTGCTGGGGGGCAGGGGG - Intronic
1061303130 9:129717910-129717932 TCTAAGTGCTGGAGGGAAGGGGG + Intronic
1061344443 9:130011029-130011051 CAGCAGAGATGGAAGGAAGGTGG + Intronic
1061416545 9:130450372-130450394 CATGCAGGATGGAGGGAAGGAGG - Intronic
1061941815 9:133887865-133887887 CTTCAGGGCTGGTGGTGAGGAGG - Intronic
1062156961 9:135055456-135055478 AATCATGGCAGGAGGCAAGGAGG + Intergenic
1062386003 9:136311816-136311838 CAGCAGGGCTGGGGGGCCGGGGG - Intergenic
1062483342 9:136762535-136762557 CTTCCGGGCTGCAGGGAAAGAGG - Intronic
1203790025 EBV:146286-146308 TATCAGCGCTGGAGGCACGGGGG - Intergenic
1185492196 X:526244-526266 CAGCAGGGGTGGGGGGACGGCGG + Intergenic
1186079293 X:5912897-5912919 CAGGAGGGAGGGAGGGAAGGAGG + Intronic
1186240014 X:7555506-7555528 AATAAGGGAAGGAGGGAAGGAGG + Intergenic
1186951381 X:14629187-14629209 CATCAGGGTTGGAAGGAATTGGG + Intronic
1188313908 X:28650337-28650359 AATCATGGCGGGAGGCAAGGAGG + Intronic
1188566881 X:31536711-31536733 CATCAGGGGAGAAGGGAAGGAGG - Intronic
1189284406 X:39841138-39841160 TTTCAGGGCTTCAGGGAAGGAGG - Intergenic
1189994917 X:46629108-46629130 TATGAGGTCTGGAAGGAAGGAGG + Intronic
1190000033 X:46677099-46677121 CTTCAGGGCAGGAGGGGAAGGGG - Intronic
1190385380 X:49879041-49879063 CATTGAGGCTGGCGGGAAGGGGG - Intergenic
1190958419 X:55220580-55220602 CATCAGGACCTGGGGGAAGGCGG - Exonic
1191664706 X:63688181-63688203 CTACAGGGCAGGAGGGAGGGGGG + Intronic
1192178614 X:68901580-68901602 CATCAGGGCTGCTGGGAGGAAGG - Intergenic
1193079181 X:77389175-77389197 AATCATGGCAGAAGGGAAGGAGG - Intergenic
1193820871 X:86163177-86163199 GTGAAGGGCTGGAGGGAAGGTGG - Intronic
1197004174 X:121475220-121475242 CATCAGGGCTGGTTGGACAGTGG - Intergenic
1197202223 X:123758161-123758183 AATCATGGCAGAAGGGAAGGAGG - Intergenic
1197290786 X:124654648-124654670 AGTTAGGGCTGGAGGGAAGAAGG + Intronic
1197699738 X:129590067-129590089 CCTCAGGGCTGGAGGGCCTGGGG - Intronic
1198250838 X:134877848-134877870 CATAAGGGTAGGAAGGAAGGAGG - Intergenic
1198309464 X:135416059-135416081 CATAAGGGCAGGAGGAAACGGGG + Intergenic
1198720365 X:139611790-139611812 AAACAGGGGTGCAGGGAAGGAGG + Intronic
1199757220 X:150875849-150875871 CATCAGGGCAGAAGGCAAGGAGG - Intronic
1199940740 X:152625227-152625249 TGACAGGGCTGGGGGGAAGGGGG + Intergenic
1200104251 X:153703558-153703580 CCTCAGTGCTGGAGAGGAGGTGG - Intronic
1200118184 X:153778340-153778362 CATCGGGGCTGCGGGGAAGGGGG + Intronic
1200156861 X:153981388-153981410 CACCAGGCCGGGAGGCAAGGGGG - Intronic
1200223262 X:154402630-154402652 CCCCAGGGCTGGATGGACGGGGG + Exonic
1200236596 X:154470704-154470726 CATCCAGGCAGGAGGGAATGAGG + Intronic
1200401814 X:156024320-156024342 ACTCAGGGCTGGAGGGGAGGAGG - Intergenic
1201851285 Y:18484007-18484029 CACCCGGGCTGGAGTGCAGGAGG + Intergenic
1201882034 Y:18836372-18836394 CACCCGGGCTGGAGTGCAGGAGG - Intergenic